Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027286 Clostridium chauvoei strain SBP 07/09 chromosome, complete genome 3 crisprs cas3,csa3,DEDDh,WYL,cas6,cas8b1,cas7b,cas5,cas4,cas1,cas2,cas3HD,DinG 0 6 3 0

Results visualization

1. CP027286
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027286_1 391813-391888 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027286_2 1113597-1115204 TypeI-B II-B
24 spacers
cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027286_3 1116768-1117458 TypeI-B II-B
10 spacers
cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027286_1 1.1|391837|28|CP027286|CRISPRCasFinder 391837-391864 28 AP014333 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C55, *** SEQUENCING IN PROGRESS *** 176-203 6 0.786
CP027286_1 1.1|391837|28|CP027286|CRISPRCasFinder 391837-391864 28 NZ_AP018256 Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome 20366-20393 6 0.786
CP027286_2 2.3|1113759|37|CP027286|CRISPRCasFinder,CRT 1113759-1113795 37 GU233956 Bacillus phage 11143, partial sequence 909-945 6 0.838
CP027286_1 1.1|391837|28|CP027286|CRISPRCasFinder 391837-391864 28 CAJDKA010000002 Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence 140826-140853 7 0.75
CP027286_1 1.1|391837|28|CP027286|CRISPRCasFinder 391837-391864 28 MN241318 Enterococcus phage PEf771, complete genome 76284-76311 7 0.75
CP027286_1 1.1|391837|28|CP027286|CRISPRCasFinder 391837-391864 28 NZ_CP006904 Clostridium botulinum 202F plasmid pCBI, complete sequence 23073-23100 7 0.75
CP027286_2 2.3|1113759|37|CP027286|CRISPRCasFinder,CRT 1113759-1113795 37 NZ_CP026602 Clostridiaceae bacterium 14S0207 plasmid unnamed2, complete sequence 9474-9510 8 0.784
CP027286_2 2.12|1114352|35|CP027286|CRISPRCasFinder,CRT 1114352-1114386 35 NZ_CP042875 Bacillus cereus strain 09 plasmid unnamed1, complete sequence 367216-367250 8 0.771
CP027286_2 2.20|1114876|36|CP027286|CRISPRCasFinder,CRT 1114876-1114911 36 MN693712 Marine virus AFVG_250M462, complete genome 26202-26237 8 0.778
CP027286_2 2.12|1114352|35|CP027286|CRISPRCasFinder,CRT 1114352-1114386 35 NC_010858 Campylobacter fetus subsp. venerealis plasmid pCFV108, complete sequence 1505-1539 9 0.743
CP027286_2 2.25|1113958|32|CP027286|PILER-CR 1113958-1113989 32 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1701388-1701419 9 0.719
CP027286_2 2.20|1114876|36|CP027286|CRISPRCasFinder,CRT 1114876-1114911 36 MG945286 UNVERIFIED: Microviridae sp. isolate 12118-1602, complete genome 1982-2017 10 0.722
CP027286_2 2.26|1114024|32|CP027286|PILER-CR 1114024-1114055 32 MT446416 UNVERIFIED: Escherichia virus TH47, complete genome 160967-160998 10 0.688

1. spacer 1.1|391837|28|CP027286|CRISPRCasFinder matches to AP014333 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C55, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.786

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
gatttaacagaaaaacctaaaagttttt	Protospacer
 *  .****************** *** 

2. spacer 1.1|391837|28|CP027286|CRISPRCasFinder matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 6, identity: 0.786

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
caaccaacagaacaacctaaaatatttc	Protospacer
.*. ******** ********* **** 

3. spacer 2.3|1113759|37|CP027286|CRISPRCasFinder,CRT matches to GU233956 (Bacillus phage 11143, partial sequence) position: , mismatch: 6, identity: 0.838

caggagtcgttgtatttgatgaaatacatgaatatga	CRISPR spacer
atggtgcagttgtatttgatgaaatacatcaatatga	Protospacer
  ** *. ********************* *******

4. spacer 1.1|391837|28|CP027286|CRISPRCasFinder matches to CAJDKA010000002 (Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
taggcaacagaaaaacctaatattcaaa	Protospacer
******************** *  .  .

5. spacer 1.1|391837|28|CP027286|CRISPRCasFinder matches to MN241318 (Enterococcus phage PEf771, complete genome) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
taggcaacagaaaaacctaatattcaaa	Protospacer
******************** *  .  .

6. spacer 1.1|391837|28|CP027286|CRISPRCasFinder matches to NZ_CP006904 (Clostridium botulinum 202F plasmid pCBI, complete sequence) position: , mismatch: 7, identity: 0.75

taggcaacagaaaaacctaaaagatttg	CRISPR spacer
atggcaagagaaaaacctgaaagatcat	Protospacer
  ***** **********.******.  

7. spacer 2.3|1113759|37|CP027286|CRISPRCasFinder,CRT matches to NZ_CP026602 (Clostridiaceae bacterium 14S0207 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.784

caggagt-----cgttgtatttgatgaaatacatgaatatga	CRISPR spacer
-----gtgcttgccttatttttgatgaaatacatgaatatga	Protospacer
     **     * **.* ***********************

8. spacer 2.12|1114352|35|CP027286|CRISPRCasFinder,CRT matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.771

agtgaaaaagaaaaggaaattagaaagaaaataag	CRISPR spacer
acagattttgaagaggaaattaaaaagaaaataag	Protospacer
*  **    ***.*********.************

9. spacer 2.20|1114876|36|CP027286|CRISPRCasFinder,CRT matches to MN693712 (Marine virus AFVG_250M462, complete genome) position: , mismatch: 8, identity: 0.778

aattaaagatactaaaaaaggttttatagacttcac---	CRISPR spacer
aattaaagatactcaaaaagatttta---attttagatg	Protospacer
************* ******.*****   *.**.*    

10. spacer 2.12|1114352|35|CP027286|CRISPRCasFinder,CRT matches to NC_010858 (Campylobacter fetus subsp. venerealis plasmid pCFV108, complete sequence) position: , mismatch: 9, identity: 0.743

agtgaaaaagaaaaggaaattagaaagaaaataag	CRISPR spacer
agacaaaaataaaagaaaattagaaagaactatac	Protospacer
**  ***** *****.*************    * 

11. spacer 2.25|1113958|32|CP027286|PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

agataagctaggtagtgaccctgctggaaaat	CRISPR spacer
taatatgctaggtagtgaccttgctgctcagg	Protospacer
 .*** **************.*****   *. 

12. spacer 2.20|1114876|36|CP027286|CRISPRCasFinder,CRT matches to MG945286 (UNVERIFIED: Microviridae sp. isolate 12118-1602, complete genome) position: , mismatch: 10, identity: 0.722

aattaaagatactaaaaaaggttttatagacttcac	CRISPR spacer
aattaaagatactaaagtaggttttatgcaaccttt	Protospacer
****************. *********. * ... .

13. spacer 2.26|1114024|32|CP027286|PILER-CR matches to MT446416 (UNVERIFIED: Escherichia virus TH47, complete genome) position: , mismatch: 10, identity: 0.688

gctgaatctggtgaggacaatgttgatataac	CRISPR spacer
attgaatctggtgagtacaaggttgaatcttt	Protospacer
..************* **** *****  .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1073439 : 1086520 12 Cyanophage(25.0%) NA NA
DBSCAN-SWA_2 1529110 : 1537827 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_3 1793828 : 1828787 41 Clostridium_phage(47.37%) tail,transposase,coat,integrase,portal attL 1798524:1798542|attR 1824189:1824207
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage