Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT985188 Micropruina glycogenica isolate 1 genome assembly, chromosome: 1 15 crisprs PrimPol,csa3,DEDDh,DinG,WYL,cas3 0 1 2 0

Results visualization

1. LT985188
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_2 278386-278544 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_3 476500-476579 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_4 713742-713855 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_5 1209616-1209689 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_6 1373665-1373797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_7 1448064-1448174 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_8 1477082-1477180 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_11 2404475-2404595 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_12 2783999-2784079 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_13 2962349-2962454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_16 3404146-3404264 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_17 3413671-3413777 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_18 3609921-3610009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_19 3693396-3693493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT985188_20 3785394-3785492 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT985188_12 12.1|2784027|25|LT985188|CRISPRCasFinder 2784027-2784051 25 MH015259 Ruegeria phage vB_RpoP-V17, complete genome 43729-43753 3 0.88
LT985188_12 12.1|2784027|25|LT985188|CRISPRCasFinder 2784027-2784051 25 NC_049435 Ruegeria phage vB_RpoP-V12, complete genome 43739-43763 3 0.88
LT985188_12 12.1|2784027|25|LT985188|CRISPRCasFinder 2784027-2784051 25 MH015253 Ruegeria phage vB_RpoP-V21, complete genome 43729-43753 3 0.88
LT985188_12 12.1|2784027|25|LT985188|CRISPRCasFinder 2784027-2784051 25 MH015257 Ruegeria phage vB_RpoP-V14, complete genome 43837-43861 3 0.88

1. spacer 12.1|2784027|25|LT985188|CRISPRCasFinder matches to MH015259 (Ruegeria phage vB_RpoP-V17, complete genome) position: , mismatch: 3, identity: 0.88

tcctcaagcctctggtgggtaatgg	CRISPR spacer
tcctcaagcctctgatgggtgatgt	Protospacer
**************.*****.*** 

2. spacer 12.1|2784027|25|LT985188|CRISPRCasFinder matches to NC_049435 (Ruegeria phage vB_RpoP-V12, complete genome) position: , mismatch: 3, identity: 0.88

tcctcaagcctctggtgggtaatgg	CRISPR spacer
tcctcaagcctctgatgggtgatgt	Protospacer
**************.*****.*** 

3. spacer 12.1|2784027|25|LT985188|CRISPRCasFinder matches to MH015253 (Ruegeria phage vB_RpoP-V21, complete genome) position: , mismatch: 3, identity: 0.88

tcctcaagcctctggtgggtaatgg	CRISPR spacer
tcctcaagcctctgatgggtgatgt	Protospacer
**************.*****.*** 

4. spacer 12.1|2784027|25|LT985188|CRISPRCasFinder matches to MH015257 (Ruegeria phage vB_RpoP-V14, complete genome) position: , mismatch: 3, identity: 0.88

tcctcaagcctctggtgggtaatgg	CRISPR spacer
tcctcaagcctctgatgggtgatgt	Protospacer
**************.*****.*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 262919 : 271565 9 Mycobacterium_phage(28.57%) transposase NA
DBSCAN-SWA_2 898426 : 940934 46 Mycobacterium_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage