Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT990039 Mordavella sp. Marseille-P3756 genome assembly, chromosome: contig00001 7 crisprs NA 0 23 0 0

Results visualization

1. LT990039
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_1 257833-257939 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_2 529702-530068 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_3 532907-535120 Orphan NA
33 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_4 551013-551408 Orphan II-B,III-A
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_5 1074066-1074172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_6 1399626-1399718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT990039_7 1985574-1985666 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT990039_3 3.37|533869|28|LT990039|PILER-CR 533869-533896 28 MN693253 Marine virus AFVG_25M311, complete genome 7831-7858 5 0.821
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 331178-331206 6 0.793
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NC_021782 Salmonella phage FSL SP-076, complete genome 34193-34221 6 0.793
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 97795-97823 6 0.793
LT990039_3 3.2|533009|30|LT990039|PILER-CR,CRISPRCasFinder,CRT 533009-533038 30 NZ_CP031226 Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence 228172-228201 6 0.8
LT990039_3 3.12|533669|30|LT990039|CRISPRCasFinder,CRT 533669-533698 30 MG592519 Vibrio phage 1.150.O._10N.222.46.A6, partial genome 53922-53951 6 0.8
LT990039_3 3.12|533669|30|LT990039|CRISPRCasFinder,CRT 533669-533698 30 MG592409 Vibrio phage 1.025.O._10N.222.46.B6, partial genome 53980-54009 6 0.8
LT990039_3 3.12|533669|30|LT990039|CRISPRCasFinder,CRT 533669-533698 30 MG592668 Vibrio phage 2.130.O._10N.222.46.C2, partial genome 54060-54089 6 0.8
LT990039_3 3.12|533669|30|LT990039|CRISPRCasFinder,CRT 533669-533698 30 MG592521 Vibrio phage 1.152.O._10N.222.46.E1, partial genome 54057-54086 6 0.8
LT990039_3 3.12|533669|30|LT990039|CRISPRCasFinder,CRT 533669-533698 30 MG592410 Vibrio phage 1.026.O._10N.222.49.C7, partial genome 54059-54088 6 0.8
LT990039_3 3.27|534659|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534659-534688 30 NZ_KT897275 Clostridium botulinum strain IFR 12/29 plasmid p12/29, complete sequence 124466-124495 6 0.8
LT990039_3 3.27|534659|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534659-534688 30 NC_023573 Staphylococcus phage phiSA012 DNA, complete genome 63810-63839 6 0.8
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 218396-218425 6 0.8
LT990039_3 3.35|533539|27|LT990039|PILER-CR 533539-533565 27 NZ_LR134422 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13 156292-156318 6 0.778
LT990039_1 1.1|257871|31|LT990039|CRISPRCasFinder 257871-257901 31 NC_013973 Erwinia amylovora ATCC 49946 plasmid 2, complete sequence 41348-41378 7 0.774
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 97794-97823 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 331178-331207 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MK433260 Streptomyces phage Namo, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MF467949 Streptomyces phage Spectropatronm, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 KX670789 Streptomyces phage OlympicHelado, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MK967386 Streptomyces phage Esketit, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN204500 Streptomyces phage Hoshi, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MT684600 Streptomyces phage TieDye, complete genome 8329-8358 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MT684589 Streptomyces phage Maya, complete genome 8627-8656 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN204495 Streptomyces phage CherryBlossom, complete genome 8636-8665 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 KX670790 Streptomyces phage Rima, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN204494 Streptomyces phage Jaylociraptor, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MK433268 Streptomyces phage Popy, complete genome 9138-9167 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN204497 Streptomyces phage Meibysrarus, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MF467948 Streptomyces phage DrGrey, complete genome 9138-9167 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MK433259 Streptomyces phage IceWarrior, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN586054 Streptomyces phage FrodoSwaggins, complete genome 9138-9167 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN586056 Streptomyces phage FidgetOrca, complete genome 8619-8648 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MN204504 Streptomyces phage Soshi, complete genome 9138-9167 7 0.767
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NC_021782 Salmonella phage FSL SP-076, complete genome 34193-34222 7 0.767
LT990039_2 2.8|529871|29|LT990039|CRISPRCasFinder 529871-529899 29 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 404930-404958 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MK433260 Streptomyces phage Namo, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MF467949 Streptomyces phage Spectropatronm, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 KX670789 Streptomyces phage OlympicHelado, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MK967386 Streptomyces phage Esketit, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN204500 Streptomyces phage Hoshi, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MT684600 Streptomyces phage TieDye, complete genome 8330-8358 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MT684589 Streptomyces phage Maya, complete genome 8628-8656 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN204495 Streptomyces phage CherryBlossom, complete genome 8637-8665 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 KX670790 Streptomyces phage Rima, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN204494 Streptomyces phage Jaylociraptor, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MK433268 Streptomyces phage Popy, complete genome 9139-9167 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN204497 Streptomyces phage Meibysrarus, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MF467948 Streptomyces phage DrGrey, complete genome 9139-9167 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MK433259 Streptomyces phage IceWarrior, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN586054 Streptomyces phage FrodoSwaggins, complete genome 9139-9167 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN586056 Streptomyces phage FidgetOrca, complete genome 8620-8648 7 0.759
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MN204504 Streptomyces phage Soshi, complete genome 9139-9167 7 0.759
LT990039_3 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT 533075-533104 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4671985-4672014 7 0.767
LT990039_3 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT 533075-533104 30 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 94164-94193 7 0.767
LT990039_3 3.15|533867|30|LT990039|CRISPRCasFinder,CRT 533867-533896 30 MN693253 Marine virus AFVG_25M311, complete genome 7831-7860 7 0.767
LT990039_3 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534329-534358 30 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 274459-274488 7 0.767
LT990039_3 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534329-534358 30 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 269438-269467 7 0.767
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1702153-1702182 7 0.767
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP051543 Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence 14147-14176 7 0.767
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 953804-953833 7 0.767
LT990039_3 3.37|533869|28|LT990039|PILER-CR 533869-533896 28 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 207321-207348 7 0.75
LT990039_2 2.3|529870|30|LT990039|PILER-CR,CRT 529870-529899 30 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 404929-404958 8 0.733
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 MK433269 Streptomyces phage Madamato, complete genome 8599-8628 8 0.733
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 33171-33199 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 183462-183490 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 674395-674423 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 130949-130977 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 137952-137980 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 56581-56609 8 0.724
LT990039_2 2.9|529937|29|LT990039|CRISPRCasFinder 529937-529965 29 MK433269 Streptomyces phage Madamato, complete genome 8600-8628 8 0.724
LT990039_3 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT 533075-533104 30 NZ_CP015597 Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence 147686-147715 8 0.733
LT990039_3 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT 533075-533104 30 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 122050-122079 8 0.733
LT990039_3 3.7|533339|30|LT990039|CRISPRCasFinder,CRT 533339-533368 30 MK448761 Streptococcus phage Javan445, complete genome 13011-13040 8 0.733
LT990039_3 3.7|533339|30|LT990039|CRISPRCasFinder,CRT 533339-533368 30 MK448760 Streptococcus phage Javan443, complete genome 13011-13040 8 0.733
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448431 Streptococcus satellite phage Javan325, complete genome 5916-5945 8 0.733
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448441 Streptococcus satellite phage Javan339, complete genome 5913-5942 8 0.733
LT990039_3 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534329-534358 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 696651-696680 8 0.733
LT990039_3 3.26|534593|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534593-534622 30 NZ_CP017590 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ09, complete sequence 32153-32182 8 0.733
LT990039_3 3.31|534923|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534923-534952 30 MH248138 Erwinia phage vB_EamM_Alexandra, complete genome 38887-38916 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_LR134444 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence 988-1017 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 642891-642920 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NC_008242 Chelativorans sp. BNC1 plasmid 1, complete sequence 154798-154827 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 115177-115206 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 113262-113291 8 0.733
LT990039_3 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534989-535018 30 NZ_CP048608 Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence 30520-30549 8 0.733
LT990039_3 3.33|535055|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 535055-535084 30 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 44022-44051 8 0.733
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 33171-33200 9 0.7
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 674394-674423 9 0.7
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 130948-130977 9 0.7
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 183462-183491 9 0.7
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 137951-137980 9 0.7
LT990039_2 2.4|529936|30|LT990039|PILER-CR,CRT 529936-529965 30 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 56580-56609 9 0.7
LT990039_2 2.5|530002|30|LT990039|PILER-CR,CRT 530002-530031 30 DQ149023 Synechococcus cyanophage syn9, complete genome 52927-52956 9 0.7
LT990039_2 2.5|530002|30|LT990039|PILER-CR,CRT 530002-530031 30 NC_008296 Synechococcus phage syn9, complete genome 52927-52956 9 0.7
LT990039_3 3.10|533537|30|LT990039|CRISPRCasFinder,CRT 533537-533566 30 NZ_LR134422 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13 156291-156320 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448635 Streptococcus satellite phage Javan748, complete genome 3167-3196 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448643 Streptococcus satellite phage Javan755, complete genome 6505-6534 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448647 Streptococcus satellite phage Javan759, complete genome 10149-10178 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448649 Streptococcus satellite phage Javan760, complete genome 4198-4227 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448615 Streptococcus satellite phage Javan728, complete genome 7021-7050 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448616 Streptococcus satellite phage Javan729, complete genome 8406-8435 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448442 Streptococcus satellite phage Javan341, complete genome 4819-4848 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448627 Streptococcus satellite phage Javan740, complete genome 6893-6922 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448439 Streptococcus satellite phage Javan337, complete genome 6007-6036 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448614 Streptococcus satellite phage Javan727, complete genome 7346-7375 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448607 Streptococcus satellite phage Javan720, complete genome 7182-7211 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448409 Streptococcus satellite phage Javan297, complete genome 6257-6286 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448610 Streptococcus satellite phage Javan723, complete genome 5356-5385 9 0.7
LT990039_3 3.15|533867|30|LT990039|CRISPRCasFinder,CRT 533867-533896 30 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 207321-207350 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KT754167 Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence 93823-93852 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP026770 Shigella flexneri Y strain 93-3063 plasmid unnamed2 63819-63848 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_014843 Escherichia coli plasmid p3521, complete sequence 53301-53330 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP024247 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2 39734-39763 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP026855 Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence 55201-55230 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_012487 Escherichia coli plasmid pO26-Vir, complete sequence 140958-140987 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 31758-31787 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 KU932021 Escherichia coli plasmid pEC3I, complete sequence 35051-35080 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP024150 Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence 3719-3748 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP054459 Escherichia coli strain SCU-103 plasmid pSCU-103-2 14006-14035 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP024254 Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence 73544-73573 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP025878 Escherichia coli strain 503458 plasmid p503458_84, complete sequence 84193-84222 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP022673 Shigella sonnei strain 866 plasmid p866, complete sequence 48554-48583 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP040455 Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence 32316-32345 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP033883 Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence 54142-54171 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 103759-103788 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_LT985278 Escherichia coli strain 499 plasmid RCS68_p, complete sequence 71527-71556 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MK396099 Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence 54178-54207 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MK455767 Escherichia coli strain Ec-2Lar plasmid pB-Ec2, complete sequence 54178-54207 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 8495-8524 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 8034-8063 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP022458 Shigella sonnei strain 2015C-3566 plasmid unnamed1, complete sequence 40735-40764 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 59314-59343 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 53754-53783 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 59314-59343 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 53754-53783 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 59314-59343 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP025625 Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence 37493-37522 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 59314-59343 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 59314-59343 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP038793 Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence 35849-35878 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP025855 Escherichia coli strain 510016 plasmid p510016_84, complete sequence 52738-52767 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP042951 Escherichia coli strain D8-1 plasmid pD8-1_2, complete sequence 23707-23736 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 MN612051 Escherichia coli strain BM21 plasmid pIP72, complete sequence 24415-24444 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 45877-45906 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP009052 Escherichia coli NCCP15648 plasmid p15648-2, complete sequence 37067-37096 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP041959 Escherichia coli strain EC2 plasmid pEC2_4, complete sequence 40114-40143 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP024887 Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence 33421-33450 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_014477 Escherichia coli plasmid pCT, complete sequence 41127-41156 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_LT985300 Escherichia coli strain ECOR 24 genome assembly, plasmid: RCS90_pI 35381-35410 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP051702 Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence 47116-47145 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP051713 Escherichia coli strain SCU-123 plasmid pSCU-123-2, complete sequence 48401-48430 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP051720 Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence 36041-36070 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP023387 Escherichia coli strain 1190 plasmid p86, complete sequence 36351-36380 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 26616-26645 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_025145 Escherichia coli plasmid pL2-87, complete sequence 17518-17547 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NC_032099 Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence 33621-33650 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP025926 Escherichia coli strain 520873 plasmid p520873_84, complete sequence 14567-14596 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP025889 Escherichia coli strain 503046 plasmid p503046_85, complete sequence 77266-77295 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 7346-7375 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP054380 Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence 65306-65335 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 30621-30650 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP032260 Escherichia coli strain AR_0067 plasmid unnamed3, complete sequence 4988-5017 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP023144 Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence 59850-59879 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 MN335640 Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence 41442-41471 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP026778 Shigella dysenteriae strain 69-3818 plasmid unnamed1 14356-14385 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP054354 Escherichia coli strain SCU-172 plasmid pSCU-172-1, complete sequence 36542-36571 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 CP052260 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence 52823-52852 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 45778-45807 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP019011 Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_1, complete sequence 27-56 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_LT985270 Escherichia coli strain 716 plasmid RCS56_p, complete sequence 51714-51743 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 53044-53073 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 49101-49130 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MF156268 Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence 42719-42748 9 0.7
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MF344576 Escherichia coli strain 15061806 plasmid p61806-CTXM, complete sequence 61632-61661 9 0.7
LT990039_3 3.31|534923|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 534923-534952 30 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 40439-40468 9 0.7
LT990039_3 3.33|535055|30|LT990039|CRISPRCasFinder,CRT,PILER-CR 535055-535084 30 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 509861-509890 9 0.7
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448641 Streptococcus satellite phage Javan753, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448618 Streptococcus satellite phage Javan731, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448643 Streptococcus satellite phage Javan755, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448652 Streptococcus satellite phage Javan763, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448628 Streptococcus satellite phage Javan741, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448615 Streptococcus satellite phage Javan728, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448621 Streptococcus satellite phage Javan734, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448442 Streptococcus satellite phage Javan341, complete genome 1181-1210 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448620 Streptococcus satellite phage Javan733, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448650 Streptococcus satellite phage Javan761, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448611 Streptococcus satellite phage Javan724, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448497 Streptococcus satellite phage Javan437, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448614 Streptococcus satellite phage Javan727, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448626 Streptococcus satellite phage Javan739, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448441 Streptococcus satellite phage Javan339, complete genome 1181-1210 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448607 Streptococcus satellite phage Javan720, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448651 Streptococcus satellite phage Javan762, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448640 Streptococcus satellite phage Javan752, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448619 Streptococcus satellite phage Javan732, complete genome 1185-1214 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448638 Streptococcus satellite phage Javan750, complete genome 1184-1213 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448410 Streptococcus satellite phage Javan298, complete genome 1180-1209 10 0.667
LT990039_3 3.11|533603|30|LT990039|CRISPRCasFinder,CRT 533603-533632 30 MK448493 Streptococcus satellite phage Javan431, complete genome 1185-1214 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KU312044 Escherichia coli strain 1292 transconjugant plasmid pNVI1292, complete sequence 65846-65875 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905386 Escherichia coli strain MSA1088 plasmid pTMSA1088, complete sequence 26723-26752 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905388 Escherichia coli strain MSA970 plasmid pTMSA970, complete sequence 28428-28457 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905387 Escherichia coli strain MSA992 plasmid pTMSA992, complete sequence 29035-29064 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905390 Escherichia coli strain DV10 plasmid pDV10, complete sequence 26703-26732 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905384 Escherichia coli strain DV45 plasmid pDV45, complete sequence 33389-33418 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905389 Escherichia coli isolate 4809.66 plasmid p4809.66, complete sequence 33381-33410 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_KR905385 Escherichia coli strain 5312.29 plasmid p5312.29, complete sequence 35708-35737 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP032880 Escherichia coli strain SCEC020022 plasmid p1_020022, complete sequence 33617-33646 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP016548 Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence 13793-13822 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_CP016548 Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence 79802-79831 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MK758104 Escherichia coli strain 0126:B16 plasmid R16, complete sequence 61447-61476 10 0.667
LT990039_3 3.16|533933|30|LT990039|CRISPRCasFinder,CRT 533933-533962 30 NZ_MK088173 Salmonella enterica subsp. enterica strain H-185 plasmid R805a, complete sequence 38430-38459 10 0.667
LT990039_4 4.2|551121|35|LT990039|CRISPRCasFinder,CRT 551121-551155 35 MT162468 Synechococcus phage S-H25, complete genome 64495-64529 10 0.714

1. spacer 3.37|533869|28|LT990039|PILER-CR matches to MN693253 (Marine virus AFVG_25M311, complete genome) position: , mismatch: 5, identity: 0.821 

tatgtgaaaataaaatatgcaggaaatg	CRISPR spacer
gctgagaatataaaatatgcaggaaata	Protospacer
  ** *** ******************.

2. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.793 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
ccgcaagacggagatcaagaccatccagc	Protospacer
.. ****.**.****************.*

3. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NC_021782 (Salmonella phage FSL SP-076, complete genome) position: , mismatch: 6, identity: 0.793 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gttgaaggcgaagatgtagaccatccaat	Protospacer
 *. ***********  ***********.

4. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.793 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
ccgcaagacggagatcaagaccatccagc	Protospacer
.. ****.**.****************.*

5. spacer 3.2|533009|30|LT990039|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 6, identity: 0.8 

ctgaccacgatgacagcccagacagcgcag	CRISPR spacer
ccgaggtcgatgacagcccagaaagcccag	Protospacer
*.**   *************** *** ***

6. spacer 3.12|533669|30|LT990039|CRISPRCasFinder,CRT matches to MG592519 (Vibrio phage 1.150.O._10N.222.46.A6, partial genome) position: , mismatch: 6, identity: 0.8 

aatcctgttacatgatgttgatgtaacggt	CRISPR spacer
catcgattaacatgatgttgatgtaatggt	Protospacer
 ***   * *****************.***

7. spacer 3.12|533669|30|LT990039|CRISPRCasFinder,CRT matches to MG592409 (Vibrio phage 1.025.O._10N.222.46.B6, partial genome) position: , mismatch: 6, identity: 0.8 

aatcctgttacatgatgttgatgtaacggt	CRISPR spacer
catcgattaacatgatgttgatgtaatggt	Protospacer
 ***   * *****************.***

8. spacer 3.12|533669|30|LT990039|CRISPRCasFinder,CRT matches to MG592668 (Vibrio phage 2.130.O._10N.222.46.C2, partial genome) position: , mismatch: 6, identity: 0.8 

aatcctgttacatgatgttgatgtaacggt	CRISPR spacer
catcgattaacatgatgttgatgtaatggt	Protospacer
 ***   * *****************.***

9. spacer 3.12|533669|30|LT990039|CRISPRCasFinder,CRT matches to MG592521 (Vibrio phage 1.152.O._10N.222.46.E1, partial genome) position: , mismatch: 6, identity: 0.8 

aatcctgttacatgatgttgatgtaacggt	CRISPR spacer
catcgattaacatgatgttgatgtaatggt	Protospacer
 ***   * *****************.***

10. spacer 3.12|533669|30|LT990039|CRISPRCasFinder,CRT matches to MG592410 (Vibrio phage 1.026.O._10N.222.49.C7, partial genome) position: , mismatch: 6, identity: 0.8 

aatcctgttacatgatgttgatgtaacggt	CRISPR spacer
catcgattaacatgatgttgatgtaatggt	Protospacer
 ***   * *****************.***

11. spacer 3.27|534659|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT897275 (Clostridium botulinum strain IFR 12/29 plasmid p12/29, complete sequence) position: , mismatch: 6, identity: 0.8 

gtatctgaagaaaaggtatggaattagtaa	CRISPR spacer
ttctctgaagaaatggtatggaaatatcaa	Protospacer
 * ********** ********* ** .**

12. spacer 3.27|534659|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NC_023573 (Staphylococcus phage phiSA012 DNA, complete genome) position: , mismatch: 6, identity: 0.8 

---gtatctgaagaaaaggtatggaattagtaa	CRISPR spacer
agtgta---aaagaaaaggtattgaattagtta	Protospacer
   ***   .************ ******** *

13. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.8 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
caccgctggtccatcatcgcctgcccgcgc	Protospacer
*.* *.***** ****************

14. spacer 3.35|533539|27|LT990039|PILER-CR matches to NZ_LR134422 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13) position: , mismatch: 6, identity: 0.778 

gtttcgcaagccttgactaccgccgga	CRISPR spacer
aattcgcaagccttaattaccgccgcg	Protospacer
. ************.*.******** .

15. spacer 1.1|257871|31|LT990039|CRISPRCasFinder matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774 

tggctgcagcaacggattcggcggaaacgac	CRISPR spacer
gcgcttcagcaacggattcggcagaagccag	Protospacer
  *** ****************.***.* *

16. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tccgcaagacggagatcaagaccatccagc	Protospacer
... ****.**.****************.*

17. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tccgcaagacggagatcaagaccatccagc	Protospacer
... ****.**.****************.*

18. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MK433260 (Streptomyces phage Namo, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

19. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MF467949 (Streptomyces phage Spectropatronm, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

20. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to KX670789 (Streptomyces phage OlympicHelado, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

21. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MK967386 (Streptomyces phage Esketit, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

22. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN204500 (Streptomyces phage Hoshi, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

23. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MT684600 (Streptomyces phage TieDye, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

24. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MT684589 (Streptomyces phage Maya, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

25. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN204495 (Streptomyces phage CherryBlossom, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

26. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to KX670790 (Streptomyces phage Rima, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

27. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN204494 (Streptomyces phage Jaylociraptor, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

28. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MK433268 (Streptomyces phage Popy, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

29. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN204497 (Streptomyces phage Meibysrarus, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

30. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MF467948 (Streptomyces phage DrGrey, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

31. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MK433259 (Streptomyces phage IceWarrior, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

32. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN586054 (Streptomyces phage FrodoSwaggins, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

33. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN586056 (Streptomyces phage FidgetOrca, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

34. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MN204504 (Streptomyces phage Soshi, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccatgcaag	Protospacer
* .. **************.***** ***

35. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NC_021782 (Salmonella phage FSL SP-076, complete genome) position: , mismatch: 7, identity: 0.767 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgttgaaggcgaagatgtagaccatccaat	Protospacer
. *. ***********  ***********.

36. spacer 2.8|529871|29|LT990039|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759 

gaagatgacatctcccggctccggcttgt	CRISPR spacer
cgtgatgacatcgcccggctccagcttca	Protospacer
 . ********* *********.****

37. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MK433260 (Streptomyces phage Namo, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

38. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MF467949 (Streptomyces phage Spectropatronm, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

39. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to KX670789 (Streptomyces phage OlympicHelado, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

40. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MK967386 (Streptomyces phage Esketit, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

41. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN204500 (Streptomyces phage Hoshi, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

42. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MT684600 (Streptomyces phage TieDye, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

43. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MT684589 (Streptomyces phage Maya, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

44. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN204495 (Streptomyces phage CherryBlossom, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

45. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to KX670790 (Streptomyces phage Rima, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

46. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN204494 (Streptomyces phage Jaylociraptor, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

47. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MK433268 (Streptomyces phage Popy, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

48. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN204497 (Streptomyces phage Meibysrarus, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

49. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MF467948 (Streptomyces phage DrGrey, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

50. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MK433259 (Streptomyces phage IceWarrior, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

51. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN586054 (Streptomyces phage FrodoSwaggins, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

52. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN586056 (Streptomyces phage FidgetOrca, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

53. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MN204504 (Streptomyces phage Soshi, complete genome) position: , mismatch: 7, identity: 0.759 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccatgcaag	Protospacer
 .. **************.***** ***

54. spacer 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacagtgtcgccgatgtcgccaaaaatgt	CRISPR spacer
cgacagcgtcgccgacgtcgccaaggccga	Protospacer
******.********.********.. .*

55. spacer 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.767 

cgacagtgtcgccgatgtcgccaaaaatgt	CRISPR spacer
cgacagtggcgccgatgtcgctcagcacgg	Protospacer
******** ************. *. *.*

56. spacer 3.15|533867|30|LT990039|CRISPRCasFinder,CRT matches to MN693253 (Marine virus AFVG_25M311, complete genome) position: , mismatch: 7, identity: 0.767 

ggtatgtgaaaataaaatatgcaggaaatg	CRISPR spacer
ctgctgagaatataaaatatgcaggaaata	Protospacer
    ** *** ******************.

57. spacer 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 7, identity: 0.767 

caaacgct-----ttctcttcctcctgcgctctct	CRISPR spacer
-----gcttctggttctcttcctccagcgctctca	Protospacer
     ***     ************ ********

58. spacer 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 7, identity: 0.767 

caaacgct-----ttctcttcctcctgcgctctct	CRISPR spacer
-----gcttctggttctcttcctccagcgctctca	Protospacer
     ***     ************ ********

59. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
gacggcgtgtcgatcatcgcctgcccggtg	Protospacer
 .*.*.  ******************* **

60. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 7, identity: 0.767 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
cccagctcgtcgatcatcgcctgccgcatc	Protospacer
* ***.* *****************   *

61. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.767 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
tgcctgtggtcgatgatcgcctgcccggcg	Protospacer
.**   ******** ************ .*

62. spacer 3.37|533869|28|LT990039|PILER-CR matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75 

tatgtgaaaataaaatatgcaggaaatg	CRISPR spacer
ggcgtgaccataaaatatgcaggaaaat	Protospacer
 ..****  *****************

63. spacer 2.3|529870|30|LT990039|PILER-CR,CRT matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

agaagatgacatctcccggctccggcttgt	CRISPR spacer
tcgtgatgacatcgcccggctccagcttca	Protospacer
  . ********* *********.****

64. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to MK433269 (Streptomyces phage Madamato, complete genome) position: , mismatch: 8, identity: 0.733 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
cgctgaaggcgaagatcaaaaccattcagg	Protospacer
* .. **************.*****.**.

65. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

66. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

67. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

68. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

69. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

70. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gcccatggcgaagatcacgaccatcgcgt	Protospacer
 .*** *********** *******  ..

71. spacer 2.9|529937|29|LT990039|CRISPRCasFinder matches to MK433269 (Streptomyces phage Madamato, complete genome) position: , mismatch: 8, identity: 0.724 

ttccaaggcgaagatcaagaccatccaac	CRISPR spacer
gctgaaggcgaagatcaaaaccattcagg	Protospacer
 .. **************.*****.**.

72. spacer 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015597 (Mycobacterium sp. YC-RL4 plasmid pMYC1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacagtgtcgccgatgtcgccaaaaatgt	CRISPR spacer
cgacactgtcgccgatgtcgccgccgcgat	Protospacer
***** ****************.  .  .*

73. spacer 3.3|533075|30|LT990039|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.733 

cgacagtgtcgccgatgtcgccaaaaatgt	CRISPR spacer
cgacattgccgccgatgtcgccaccgcatt	Protospacer
***** **.**************  .   *

74. spacer 3.7|533339|30|LT990039|CRISPRCasFinder,CRT matches to MK448761 (Streptococcus phage Javan445, complete genome) position: , mismatch: 8, identity: 0.733 

ctagtggatttgtgaaagcaaagaacgatt	CRISPR spacer
ttgttggatttgtcaaagcaaagaatactg	Protospacer
.*. ********* ***********.. *

75. spacer 3.7|533339|30|LT990039|CRISPRCasFinder,CRT matches to MK448760 (Streptococcus phage Javan443, complete genome) position: , mismatch: 8, identity: 0.733 

ctagtggatttgtgaaagcaaagaacgatt	CRISPR spacer
ttgttggatttgtcaaagcaaagaatactg	Protospacer
.*. ********* ***********.. *

76. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448431 (Streptococcus satellite phage Javan325, complete genome) position: , mismatch: 8, identity: 0.733 

-agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
taatg-gcaggcaagcaattagaaaagattt	Protospacer
 *..*  **** ****************

77. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448441 (Streptococcus satellite phage Javan339, complete genome) position: , mismatch: 8, identity: 0.733 

-agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
taatg-gcaggcaagcaattagaaaagattt	Protospacer
 *..*  **** ****************

78. spacer 3.22|534329|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733 

caaacgctttctcttcctcctgcgctctct	CRISPR spacer
cttgcgctttcccttcgtcctgcgctcgag	Protospacer
*  .*******.**** **********

79. spacer 3.26|534593|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017590 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ09, complete sequence) position: , mismatch: 8, identity: 0.733 

taaggtcagttatgacaaggggacaggaga	CRISPR spacer
gacattcagttatgacaagagaacaggacg	Protospacer
 * . **************.*.****** .

80. spacer 3.31|534923|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to MH248138 (Erwinia phage vB_EamM_Alexandra, complete genome) position: , mismatch: 8, identity: 0.733 

ttttacaaacaggcgcagggagagcaggta	CRISPR spacer
cttttcaaacaggtgcagggagagagcggc	Protospacer
.*** ********.********** . *

81. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134444 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
agcaggtggtcgatcatctcctgccgctcc	Protospacer
 **** ************ ******  ..

82. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
acctgctggtcgatcatcgcctggccgacc	Protospacer
  * *.***************** *** .

83. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
ggcagttggacgatcatcggctgctggacc	Protospacer
 ******** ********* ****. * .

84. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
tgtctgtggtcgatgatcgcctgcccggcg	Protospacer
.*.   ******** ************ .*

85. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
tgtctgtggtcgatgatcgcctgcccggcg	Protospacer
.*.   ******** ************ .*

86. spacer 3.32|534989|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048608 (Pseudomonas fluorescens strain DR133 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

cgcagttggtcgatcatcgcctgcccgctg	CRISPR spacer
gggcgttggtcgatcatcgcttgcgcgtac	Protospacer
 *  ****************.*** **.

87. spacer 3.33|535055|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 8, identity: 0.733 

tatgttgagtgaagccgcagaaacaggtct	CRISPR spacer
catgtggagtcaagccgcagaaaccaatga	Protospacer
.**** **** ************* ..*

88. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

89. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

90. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

91. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

92. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

93. spacer 2.4|529936|30|LT990039|PILER-CR,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.7 

cttccaaggcgaagatcaagaccatccaac	CRISPR spacer
tgcccatggcgaagatcacgaccatcgcgt	Protospacer
. .*** *********** *******  ..

94. spacer 2.5|530002|30|LT990039|PILER-CR,CRT matches to DQ149023 (Synechococcus cyanophage syn9, complete genome) position: , mismatch: 9, identity: 0.7 

cctttgattctctcaaaccaatccgtgaag	CRISPR spacer
cctttgattatctcaaacaaatcaaatggt	Protospacer
********* ******** **** .  ..

95. spacer 2.5|530002|30|LT990039|PILER-CR,CRT matches to NC_008296 (Synechococcus phage syn9, complete genome) position: , mismatch: 9, identity: 0.7 

cctttgattctctcaaaccaatccgtgaag	CRISPR spacer
cctttgattatctcaaacaaatcaaatggt	Protospacer
********* ******** **** .  ..

96. spacer 3.10|533537|30|LT990039|CRISPRCasFinder,CRT matches to NZ_LR134422 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 13) position: , mismatch: 9, identity: 0.7 

atgtttcgcaagccttgactaccgccggaa	CRISPR spacer
ccaattcgcaagccttaattaccgccgcgt	Protospacer
 .. ************.*.******** .

97. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448635 (Streptococcus satellite phage Javan748, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtacaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

98. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448643 (Streptococcus satellite phage Javan755, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

99. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448647 (Streptococcus satellite phage Javan759, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

100. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448649 (Streptococcus satellite phage Javan760, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

101. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448615 (Streptococcus satellite phage Javan728, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

102. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448616 (Streptococcus satellite phage Javan729, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

103. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448442 (Streptococcus satellite phage Javan341, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

104. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448627 (Streptococcus satellite phage Javan740, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

105. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448439 (Streptococcus satellite phage Javan337, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

106. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448614 (Streptococcus satellite phage Javan727, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

107. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448607 (Streptococcus satellite phage Javan720, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

108. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448409 (Streptococcus satellite phage Javan297, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

109. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448610 (Streptococcus satellite phage Javan723, complete genome) position: , mismatch: 9, identity: 0.7 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
gaagtgcaggcaagcaattagaaaaggttt	Protospacer
.. ** **** ***************.

110. spacer 3.15|533867|30|LT990039|CRISPRCasFinder,CRT matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

ggtatgtgaaaataaaatatgcaggaaatg	CRISPR spacer
aaggcgtgaccataaaatatgcaggaaaat	Protospacer
.. ..****  *****************

111. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KT754167 (Shigella dysenteriae 1 strain 69-3818 plasmid p69-3818, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

112. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP026770 (Shigella flexneri Y strain 93-3063 plasmid unnamed2) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

113. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_014843 (Escherichia coli plasmid p3521, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

114. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP024247 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed2) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

115. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP026855 (Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

116. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_012487 (Escherichia coli plasmid pO26-Vir, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

117. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

118. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

119. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP024150 (Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

120. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP054459 (Escherichia coli strain SCU-103 plasmid pSCU-103-2) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

121. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP024254 (Escherichia coli strain ATCC 43886 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

122. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP025878 (Escherichia coli strain 503458 plasmid p503458_84, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

123. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP022673 (Shigella sonnei strain 866 plasmid p866, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

124. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP040455 (Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

125. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP033883 (Escherichia coli strain 50579417 plasmid p50579417_2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

126. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP027379 (Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

127. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_LT985278 (Escherichia coli strain 499 plasmid RCS68_p, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

128. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MK396099 (Escherichia coli strain Ec20-Lar plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

129. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MK455767 (Escherichia coli strain Ec-2Lar plasmid pB-Ec2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

130. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

131. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

132. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP022458 (Shigella sonnei strain 2015C-3566 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

133. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

134. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

135. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

136. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

137. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

138. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

139. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

140. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

141. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP038793 (Escherichia coli strain PF9285 plasmid pDW54_2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

142. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP025855 (Escherichia coli strain 510016 plasmid p510016_84, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

143. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP042951 (Escherichia coli strain D8-1 plasmid pD8-1_2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

144. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to MN612051 (Escherichia coli strain BM21 plasmid pIP72, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

145. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

146. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP009052 (Escherichia coli NCCP15648 plasmid p15648-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

147. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP041959 (Escherichia coli strain EC2 plasmid pEC2_4, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

148. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP024887 (Escherichia coli strain AR_0017 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

149. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_014477 (Escherichia coli plasmid pCT, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

150. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_LT985300 (Escherichia coli strain ECOR 24 genome assembly, plasmid: RCS90_pI) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

151. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP051702 (Escherichia coli strain SCU-125 plasmid pSCU-125-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

152. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP051713 (Escherichia coli strain SCU-123 plasmid pSCU-123-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

153. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP051720 (Escherichia coli strain SCU-116 plasmid pSCU-116-1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

154. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP023387 (Escherichia coli strain 1190 plasmid p86, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

155. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

156. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_025145 (Escherichia coli plasmid pL2-87, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

157. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NC_032099 (Shigella dysenteriae 1 strain 92-9000 plasmid p92-9000, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

158. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP025926 (Escherichia coli strain 520873 plasmid p520873_84, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

159. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP025889 (Escherichia coli strain 503046 plasmid p503046_85, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

160. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

161. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP054380 (Escherichia coli strain SCU-175 plasmid pSCU-175-1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

162. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

163. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP032260 (Escherichia coli strain AR_0067 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

164. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP023144 (Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

165. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to MN335640 (Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

166. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP026778 (Shigella dysenteriae strain 69-3818 plasmid unnamed1) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

167. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP054354 (Escherichia coli strain SCU-172 plasmid pSCU-172-1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

168. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to CP052260 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-2, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

169. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

170. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP019011 (Escherichia coli strain Ecol_AZ161 plasmid pECAZ161_1, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

171. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_LT985270 (Escherichia coli strain 716 plasmid RCS56_p, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

172. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

173. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

174. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MF156268 (Escherichia coli strain 3-S1R plasmid pCERC10, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

175. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MF344576 (Escherichia coli strain 15061806 plasmid p61806-CTXM, complete sequence) position: , mismatch: 9, identity: 0.7 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagtcaa	Protospacer
..*******.*************   * .

176. spacer 3.31|534923|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 9, identity: 0.7 

ttttacaaacaggcgcagggagagcaggta	CRISPR spacer
tgaggtcaacaggcgcacggagagcaggcc	Protospacer
*   .. ********** **********.

177. spacer 3.33|535055|30|LT990039|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.7 

tatgttgagtgaagccgcagaaacaggtct	CRISPR spacer
ccgaatgggtgaaggcgcagaaacaggtgc	Protospacer
.  . **.****** ************* .

178. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448641 (Streptococcus satellite phage Javan753, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

179. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448618 (Streptococcus satellite phage Javan731, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

180. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448643 (Streptococcus satellite phage Javan755, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

181. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448652 (Streptococcus satellite phage Javan763, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

182. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448628 (Streptococcus satellite phage Javan741, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

183. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448615 (Streptococcus satellite phage Javan728, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

184. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448621 (Streptococcus satellite phage Javan734, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

185. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448442 (Streptococcus satellite phage Javan341, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

186. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448620 (Streptococcus satellite phage Javan733, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

187. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448650 (Streptococcus satellite phage Javan761, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

188. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448611 (Streptococcus satellite phage Javan724, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

189. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448497 (Streptococcus satellite phage Javan437, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

190. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448614 (Streptococcus satellite phage Javan727, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

191. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448626 (Streptococcus satellite phage Javan739, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

192. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448441 (Streptococcus satellite phage Javan339, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

193. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448607 (Streptococcus satellite phage Javan720, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

194. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448651 (Streptococcus satellite phage Javan762, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

195. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448640 (Streptococcus satellite phage Javan752, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

196. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448619 (Streptococcus satellite phage Javan732, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

197. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448638 (Streptococcus satellite phage Javan750, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

198. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448410 (Streptococcus satellite phage Javan298, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

199. spacer 3.11|533603|30|LT990039|CRISPRCasFinder,CRT matches to MK448493 (Streptococcus satellite phage Javan431, complete genome) position: , mismatch: 10, identity: 0.667 

agcgttcaggaaagcaattagaaaagaaag	CRISPR spacer
catcagcaggcaagcaattagaaaagattt	Protospacer
 ..   **** ****************

200. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KU312044 (Escherichia coli strain 1292 transconjugant plasmid pNVI1292, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

201. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905386 (Escherichia coli strain MSA1088 plasmid pTMSA1088, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

202. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905388 (Escherichia coli strain MSA970 plasmid pTMSA970, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

203. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905387 (Escherichia coli strain MSA992 plasmid pTMSA992, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

204. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905390 (Escherichia coli strain DV10 plasmid pDV10, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

205. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905384 (Escherichia coli strain DV45 plasmid pDV45, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

206. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905389 (Escherichia coli isolate 4809.66 plasmid p4809.66, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

207. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_KR905385 (Escherichia coli strain 5312.29 plasmid p5312.29, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

208. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP032880 (Escherichia coli strain SCEC020022 plasmid p1_020022, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

209. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP016548 (Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

210. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_CP016548 (Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

211. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MK758104 (Escherichia coli strain 0126:B16 plasmid R16, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

212. spacer 3.16|533933|30|LT990039|CRISPRCasFinder,CRT matches to NZ_MK088173 (Salmonella enterica subsp. enterica strain H-185 plasmid R805a, complete sequence) position: , mismatch: 10, identity: 0.667 

atacttcctatgcctgttcccgtctctggt	CRISPR spacer
gcacttcctgtgcctgttcccgtgagccaa	Protospacer
..*******.*************   . .

213. spacer 4.2|551121|35|LT990039|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 10, identity: 0.714 

ctgtctcgataagaatattaaagataggacctgac	CRISPR spacer
cattaacgatacgaatattagagataggaccaact	Protospacer
*  *  ***** ********.********** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage