CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
LT991957_1 |
1.1|4746021|27|LT991957|CRISPRCasFinder |
4746021-4746047 |
27 |
MN013086 |
Klebsiella phage vB_Kpn_Chronis, complete genome |
33543-33569 |
2 |
0.926 |
LT991957_1 |
1.1|4746021|27|LT991957|CRISPRCasFinder |
4746021-4746047 |
27 |
NZ_LR134256 |
Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence |
1565-1591 |
2 |
0.926 |
1. spacer 1.1|4746021|27|LT991957|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 2, identity: 0.926
ctccacctccacaggcattggtacgac CRISPR spacer
atccacctccgcaggcattggtacgac Protospacer
*********.****************
2. spacer 1.1|4746021|27|LT991957|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.926
ctccacctccacaggcattggtacgac CRISPR spacer
ctccacctccgcaggcattggtactac Protospacer
**********.************* **