Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992434 Staphylococcus aureus isolate 1549-WT genome assembly, chromosome: I 3 crisprs NA 1 0 0 0

Results visualization

1. LT992434
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992434_1 1239979-1240117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992434_2 1430965-1431058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992434_3 2437160-2437261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992434_1 1.1|1240030|37|LT992434|CRISPRCasFinder 1240030-1240066 37 LT992434.1 1239941-1239977 2 0.946

1. spacer 1.1|1240030|37|LT992434|CRISPRCasFinder matches to position: 1239941-1239977, mismatch: 2, identity: 0.946 

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage