Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992436 Staphylococcus aureus isolate 1549-REV genome assembly, chromosome: I 4 crisprs NA 2 0 0 0

Results visualization

1. LT992436
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992436_1 1239985-1240123 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992436_2 1430971-1431064 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992436_3 2437182-2437283 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992436_4 2647048-2647193 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 30035-30048 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 130496-130509 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 350011-350024 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1267738-1267751 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1278544-1278557 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1278658-1278671 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1278718-1278731 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1313112-1313125 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1471625-1471638 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 1983162-1983175 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 2020315-2020328 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 2542274-2542287 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 2598342-2598355 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 2647194-2647207 0 1.0
LT992436_4 4.2|2647165|14|LT992436|PILER-CR 2647165-2647178 14 LT992436.1 2647250-2647263 0 1.0
LT992436_1 1.1|1240036|37|LT992436|CRISPRCasFinder 1240036-1240072 37 LT992436.1 1239947-1239983 2 0.946

1. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 30035-30048, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

2. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 130496-130509, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

3. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 350011-350024, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

4. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1267738-1267751, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

5. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1278544-1278557, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

6. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1278658-1278671, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

7. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1278718-1278731, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

8. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1313112-1313125, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

9. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1471625-1471638, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

10. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 1983162-1983175, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

11. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 2020315-2020328, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

12. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 2542274-2542287, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

13. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 2598342-2598355, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

14. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 2647194-2647207, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

15. spacer 4.2|2647165|14|LT992436|PILER-CR matches to position: 2647250-2647263, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

16. spacer 1.1|1240036|37|LT992436|CRISPRCasFinder matches to position: 1239947-1239983, mismatch: 2, identity: 0.946

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage