Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992435 Staphylococcus aureus isolate 1549-SCV genome assembly, chromosome: I 4 crisprs NA 2 0 0 0

Results visualization

1. LT992435
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992435_1 1239985-1240123 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992435_2 1430970-1431063 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992435_3 2437181-2437282 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992435_4 2647047-2647192 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 30035-30048 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 130496-130509 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 350011-350024 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1267737-1267750 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1278543-1278556 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1278657-1278670 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1278717-1278730 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1313111-1313124 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1471624-1471637 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 1983161-1983174 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 2020314-2020327 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 2542273-2542286 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 2598341-2598354 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 2647193-2647206 0 1.0
LT992435_4 4.2|2647164|14|LT992435|PILER-CR 2647164-2647177 14 LT992435.1 2647249-2647262 0 1.0
LT992435_1 1.1|1240036|37|LT992435|CRISPRCasFinder 1240036-1240072 37 LT992435.1 1239947-1239983 2 0.946

1. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 30035-30048, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

2. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 130496-130509, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

3. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 350011-350024, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

4. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1267737-1267750, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

5. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1278543-1278556, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

6. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1278657-1278670, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

7. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1278717-1278730, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

8. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1313111-1313124, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

9. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1471624-1471637, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

10. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 1983161-1983174, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

11. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 2020314-2020327, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

12. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 2542273-2542286, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

13. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 2598341-2598354, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

14. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 2647193-2647206, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

15. spacer 4.2|2647164|14|LT992435|PILER-CR matches to position: 2647249-2647262, mismatch: 0, identity: 1.0

cttacaataatgtg	CRISPR spacer
cttacaataatgtg	Protospacer
**************

16. spacer 1.1|1240036|37|LT992435|CRISPRCasFinder matches to position: 1239947-1239983, mismatch: 2, identity: 0.946

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage