Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992464 Staphylococcus aureus isolate 3_LA_115 genome assembly, chromosome: I 9 crisprs NA 2 1 0 0

Results visualization

1. LT992464
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_1 42150-42283 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_2 45694-45827 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_3 70291-70385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_4 114638-114716 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_5 410370-410520 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_6 465939-466151 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_7 836450-836532 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_8 1761980-1762060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992464_9 1973656-1973764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992464_4 4.1|114661|33|LT992464|CRISPRCasFinder 114661-114693 33 LT992464.1 2373289-2373321 2 0.939
LT992464_8 8.1|1762005|31|LT992464|CRISPRCasFinder 1762005-1762035 31 LT992464.1 1816959-1816989 2 0.935

1. spacer 4.1|114661|33|LT992464|CRISPRCasFinder matches to position: 2373289-2373321, mismatch: 2, identity: 0.939 

cagtagctggcggaaagtcagcttacaataatg	CRISPR spacer
cagaagctggcgaaaagtcagcttacaataatg	Protospacer
*** ********.********************

2. spacer 8.1|1762005|31|LT992464|CRISPRCasFinder matches to position: 1816959-1816989, mismatch: 2, identity: 0.935 

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992464_6 6.2|466071|34|LT992464|CRISPRCasFinder 466071-466104 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992464_6 6.2|466071|34|LT992464|CRISPRCasFinder 466071-466104 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 6.2|466071|34|LT992464|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676 

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************.....

2. spacer 6.2|466071|34|LT992464|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676 

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************.....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage