Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992458 Staphylococcus aureus isolate 7_4623 genome assembly, chromosome: I 9 crisprs NA 2 1 0 0

Results visualization

1. LT992458
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_1 850462-850595 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_2 854006-854139 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_3 878603-878697 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_4 922950-923028 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_5 1218685-1218835 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_6 1287611-1287823 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_7 1661210-1661292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_8 2545543-2545623 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992458_9 2757153-2757261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992458_4 4.1|922973|33|LT992458|CRISPRCasFinder 922973-923005 33 LT992458.1 299200-299232 2 0.939
LT992458_8 8.1|2545568|31|LT992458|CRISPRCasFinder 2545568-2545598 31 LT992458.1 2600522-2600552 2 0.935

1. spacer 4.1|922973|33|LT992458|CRISPRCasFinder matches to position: 299200-299232, mismatch: 2, identity: 0.939 

cagtagctggcggaaagtcagcttacaataatg	CRISPR spacer
cagaagctggcgaaaagtcagcttacaataatg	Protospacer
*** ********.********************

2. spacer 8.1|2545568|31|LT992458|CRISPRCasFinder matches to position: 2600522-2600552, mismatch: 2, identity: 0.935 

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992458_6 6.2|1287743|34|LT992458|CRISPRCasFinder 1287743-1287776 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992458_6 6.2|1287743|34|LT992458|CRISPRCasFinder 1287743-1287776 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 6.2|1287743|34|LT992458|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676 

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************.....

2. spacer 6.2|1287743|34|LT992458|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676 

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************.....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage