Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992462 Staphylococcus aureus isolate 5_3949 genome assembly, chromosome: I 11 crisprs NA 5 4 0 0

Results visualization

1. LT992462
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_1 331074-331166 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_2 680593-680673 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_3 982939-983047 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_4 1551972-1552054 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_5 1640326-1640419 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_6 1904597-1904809 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_7 1960228-1960378 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_8 2124216-2124301 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_9 2300365-2300459 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_10 2328310-2328420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992462_11 2872926-2873125 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 LT992462.1 1738126-1738151 0 1.0
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 1429461-1429486 0 1.0
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 684991-685016 1 0.962
LT992462_2 2.1|680618|31|LT992462|CRISPRCasFinder 680618-680648 31 LT992462.1 823159-823189 2 0.935
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 199063-199088 2 0.923
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 635911-635936 2 0.923
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 680846-680871 2 0.923
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 1915709-1915734 2 0.923
LT992462_8 8.1|2124246|26|LT992462|CRISPRCasFinder 2124246-2124271 26 LT992462.1 2256077-2256102 2 0.923
LT992462_11 11.1|2872957|25|LT992462|CRISPRCasFinder 2872957-2872981 25 LT992462.1 2873126-2873150 2 0.92
LT992462_11 11.2|2873013|25|LT992462|CRISPRCasFinder 2873013-2873037 25 LT992462.1 1915671-1915695 2 0.92

1. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to position: 1738126-1738151, mismatch: 0, identity: 1.0

agaatttcaaaaaagaaattctacag	CRISPR spacer
agaatttcaaaaaagaaattctacag	Protospacer
**************************

2. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 1429461-1429486, mismatch: 0, identity: 1.0

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
**************************

3. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 684991-685016, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagctgacgg	Protospacer
**********************.***

4. spacer 2.1|680618|31|LT992462|CRISPRCasFinder matches to position: 823159-823189, mismatch: 2, identity: 0.935

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

5. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 199063-199088, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaaactggcgg	Protospacer
*************.****.*******

6. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 635911-635936, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagaagctggtgg	Protospacer
*************.*********.**

7. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 680846-680871, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagtagcaggcgg	Protospacer
**************** *** *****

8. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 1915709-1915734, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacaaaagctggcgg	Protospacer
*************.*.**********

9. spacer 8.1|2124246|26|LT992462|CRISPRCasFinder matches to position: 2256077-2256102, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacacagtagctggcgg	Protospacer
*************.** *********

10. spacer 11.1|2872957|25|LT992462|CRISPRCasFinder matches to position: 2873126-2873150, mismatch: 2, identity: 0.92

ggcgaaaatacagcttacaataatg	CRISPR spacer
ggcgaaaagtcagcttacaataatg	Protospacer
********  ***************

11. spacer 11.2|2873013|25|LT992462|CRISPRCasFinder matches to position: 1915671-1915695, mismatch: 2, identity: 0.92

ttggaacagcaatttctacagacaa	CRISPR spacer
ttggaacaccaattcctacagacaa	Protospacer
******** *****.**********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992462_11 11.1|2872957|25|LT992462|CRISPRCasFinder 2872957-2872981 25 NC_014792 Enterobacteria phage vB_EcoM-VR7, complete genome 154175-154199 3 0.88
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 NZ_CP053838 Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence 17379-17404 4 0.846
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 NZ_CP017210 Borreliella burgdorferi strain B331 plasmid B331_cp9, complete sequence 2023-2048 4 0.846
LT992462_11 11.2|2873013|25|LT992462|CRISPRCasFinder 2873013-2873037 25 MW117966 Synechococcus phage S-H9-1, complete genome 42366-42390 4 0.84
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 NC_008443 Borrelia burgdorferi strain Ip21 plasmid, complete sequence 5652-5677 5 0.808
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 NC_010631 Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence 3460-3485 5 0.808
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 NC_010632 Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence 13739-13764 5 0.808
LT992462_11 11.2|2873013|25|LT992462|CRISPRCasFinder 2873013-2873037 25 NZ_CP038259 Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence 11151-11175 5 0.8
LT992462_5 5.1|1640360|26|LT992462|CRISPRCasFinder 1640360-1640385 26 MK448662 Streptococcus satellite phage Javan97, complete genome 6198-6223 6 0.769
LT992462_11 11.2|2873013|25|LT992462|CRISPRCasFinder 2873013-2873037 25 NZ_CP047617 Lactococcus raffinolactis strain Lr_19_5 plasmid pLraf_19_5_1, complete sequence 79395-79419 6 0.76
LT992462_6 6.1|1904644|34|LT992462|CRISPRCasFinder 1904644-1904677 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992462_6 6.1|1904644|34|LT992462|CRISPRCasFinder 1904644-1904677 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 11.1|2872957|25|LT992462|CRISPRCasFinder matches to NC_014792 (Enterobacteria phage vB_EcoM-VR7, complete genome) position: , mismatch: 3, identity: 0.88

ggcgaaaatacagcttacaataatg	CRISPR spacer
gacgaaaatacatattacaataatg	Protospacer
*.**********  ***********

2. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to NZ_CP053838 (Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence) position: , mismatch: 4, identity: 0.846

agaatttcaaaaaagaaattctacag	CRISPR spacer
agaatttcaaaaaataaaatctattg	Protospacer
************** *** ****. *

3. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to NZ_CP017210 (Borreliella burgdorferi strain B331 plasmid B331_cp9, complete sequence) position: , mismatch: 4, identity: 0.846

agaatttcaaaaaagaaattctacag	CRISPR spacer
acaatttcaaaaaagaaatattacac	Protospacer
* ***************** .**** 

4. spacer 11.2|2873013|25|LT992462|CRISPRCasFinder matches to MW117966 (Synechococcus phage S-H9-1, complete genome) position: , mismatch: 4, identity: 0.84

ttggaacagcaatttctacagacaa	CRISPR spacer
ttggaacagcaatttctactggtat	Protospacer
******************* *..* 

5. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to NC_008443 (Borrelia burgdorferi strain Ip21 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
ccaatttcaaaaaagaaattttccac	Protospacer
  ******************.* ** 

6. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to NC_010631 (Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
tgaatgtcaaaaaagaaattcttgaa	Protospacer
 **** ****************  *.

7. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to NC_010632 (Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
tgaatgtcaaaaaagaaattcttgaa	Protospacer
 **** ****************  *.

8. spacer 11.2|2873013|25|LT992462|CRISPRCasFinder matches to NZ_CP038259 (Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence) position: , mismatch: 5, identity: 0.8

ttggaacagcaatttctacagacaa	CRISPR spacer
ctggaacagcaatttctccagaggt	Protospacer
.**************** **** . 

9. spacer 5.1|1640360|26|LT992462|CRISPRCasFinder matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 6, identity: 0.769

agaatttcaaaaaagaaattctacag	CRISPR spacer
gctttttcaaaaaagaaattctagac	Protospacer
.   ******************* * 

10. spacer 11.2|2873013|25|LT992462|CRISPRCasFinder matches to NZ_CP047617 (Lactococcus raffinolactis strain Lr_19_5 plasmid pLraf_19_5_1, complete sequence) position: , mismatch: 6, identity: 0.76

ttggaacagcaatttctacagacaa	CRISPR spacer
ctggaacagcaatttctacattatc	Protospacer
.*******************     

11. spacer 6.1|1904644|34|LT992462|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tgctggtaccacgatgcgtcttgatgtagtgcta	CRISPR spacer
gatcaataccacgatgcgtcttgaagtggtagaa	Protospacer
 .....****************** **.**.  *

12. spacer 6.1|1904644|34|LT992462|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tgctggtaccacgatgcgtcttgatgtagtgcta	CRISPR spacer
gatcaataccacgatgcgtcttgaagtggtagaa	Protospacer
 .....****************** **.**.  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage