Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
LT992462 | Staphylococcus aureus isolate 5_3949 genome assembly, chromosome: I | 11 crisprs | 5 | 4 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_1 | 331074-331166 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_2 | 680593-680673 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_3 | 982939-983047 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_4 | 1551972-1552054 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_5 | 1640326-1640419 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_6 | 1904597-1904809 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_7 | 1960228-1960378 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_8 | 2124216-2124301 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_9 | 2300365-2300459 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_10 | 2328310-2328420 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992462_11 | 2872926-2873125 | Orphan |
NA
|
3 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
LT992462_5 | 1640360-1640385 | 26 | LT992462.1 | 1738126-1738151 | 0 | 1.0 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 1429461-1429486 | 0 | 1.0 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 684991-685016 | 1 | 0.962 | |
LT992462_2 | 680618-680648 | 31 | LT992462.1 | 823159-823189 | 2 | 0.935 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 199063-199088 | 2 | 0.923 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 635911-635936 | 2 | 0.923 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 680846-680871 | 2 | 0.923 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 1915709-1915734 | 2 | 0.923 | |
LT992462_8 | 2124246-2124271 | 26 | LT992462.1 | 2256077-2256102 | 2 | 0.923 | |
LT992462_11 | 2872957-2872981 | 25 | LT992462.1 | 2873126-2873150 | 2 | 0.92 | |
LT992462_11 | 2873013-2873037 | 25 | LT992462.1 | 1915671-1915695 | 2 | 0.92 |
agaatttcaaaaaagaaattctacag CRISPR spacer agaatttcaaaaaagaaattctacag Protospacer **************************
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacatagaagctggcgg Protospacer **************************
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacatagaagctgacgg Protospacer **********************.***
atcacttatgctttattatgtattggttctt CRISPR spacer atcactaatgatttattatgtattggttctt Protospacer ****** *** ********************
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacacagaaactggcgg Protospacer *************.****.*******
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacacagaagctggtgg Protospacer *************.*********.**
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacatagtagcaggcgg Protospacer **************** *** *****
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacacaaaagctggcgg Protospacer *************.*.**********
cggggccccaacatagaagctggcgg CRISPR spacer cggggccccaacacagtagctggcgg Protospacer *************.** *********
ggcgaaaatacagcttacaataatg CRISPR spacer ggcgaaaagtcagcttacaataatg Protospacer ******** ***************
ttggaacagcaatttctacagacaa CRISPR spacer ttggaacaccaattcctacagacaa Protospacer ******** *****.**********
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
LT992462_11 | 2872957-2872981 | 25 | NC_014792 | Enterobacteria phage vB_EcoM-VR7, complete genome | 154175-154199 | 3 | 0.88 | |
LT992462_5 | 1640360-1640385 | 26 | NZ_CP053838 | Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence | 17379-17404 | 4 | 0.846 | |
LT992462_5 | 1640360-1640385 | 26 | NZ_CP017210 | Borreliella burgdorferi strain B331 plasmid B331_cp9, complete sequence | 2023-2048 | 4 | 0.846 | |
LT992462_11 | 2873013-2873037 | 25 | MW117966 | Synechococcus phage S-H9-1, complete genome | 42366-42390 | 4 | 0.84 | |
LT992462_5 | 1640360-1640385 | 26 | NC_008443 | Borrelia burgdorferi strain Ip21 plasmid, complete sequence | 5652-5677 | 5 | 0.808 | |
LT992462_5 | 1640360-1640385 | 26 | NC_010631 | Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence | 3460-3485 | 5 | 0.808 | |
LT992462_5 | 1640360-1640385 | 26 | NC_010632 | Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence | 13739-13764 | 5 | 0.808 | |
LT992462_11 | 2873013-2873037 | 25 | NZ_CP038259 | Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence | 11151-11175 | 5 | 0.8 | |
LT992462_5 | 1640360-1640385 | 26 | MK448662 | Streptococcus satellite phage Javan97, complete genome | 6198-6223 | 6 | 0.769 | |
LT992462_11 | 2873013-2873037 | 25 | NZ_CP047617 | Lactococcus raffinolactis strain Lr_19_5 plasmid pLraf_19_5_1, complete sequence | 79395-79419 | 6 | 0.76 | |
LT992462_6 | 1904644-1904677 | 34 | NC_027332 | Acinetobacter phage YMC13/03/R2096, complete genome | 68639-68672 | 11 | 0.676 | |
LT992462_6 | 1904644-1904677 | 34 | KY000079 | Acinetobacter phage AM24, complete genome | 74925-74958 | 11 | 0.676 |
ggcgaaaatacagcttacaataatg CRISPR spacer gacgaaaatacatattacaataatg Protospacer *.********** ***********
agaatttcaaaaaagaaattctacag CRISPR spacer agaatttcaaaaaataaaatctattg Protospacer ************** *** ****. *
agaatttcaaaaaagaaattctacag CRISPR spacer acaatttcaaaaaagaaatattacac Protospacer * ***************** .****
ttggaacagcaatttctacagacaa CRISPR spacer ttggaacagcaatttctactggtat Protospacer ******************* *..*
agaatttcaaaaaagaaattctacag CRISPR spacer ccaatttcaaaaaagaaattttccac Protospacer ******************.* **
agaatttcaaaaaagaaattctacag CRISPR spacer tgaatgtcaaaaaagaaattcttgaa Protospacer **** **************** *.
agaatttcaaaaaagaaattctacag CRISPR spacer tgaatgtcaaaaaagaaattcttgaa Protospacer **** **************** *.
ttggaacagcaatttctacagacaa CRISPR spacer ctggaacagcaatttctccagaggt Protospacer .**************** **** .
agaatttcaaaaaagaaattctacag CRISPR spacer gctttttcaaaaaagaaattctagac Protospacer . ******************* *
ttggaacagcaatttctacagacaa CRISPR spacer ctggaacagcaatttctacattatc Protospacer .*******************
tgctggtaccacgatgcgtcttgatgtagtgcta CRISPR spacer gatcaataccacgatgcgtcttgaagtggtagaa Protospacer .....****************** **.**. *
tgctggtaccacgatgcgtcttgatgtagtgcta CRISPR spacer gatcaataccacgatgcgtcttgaagtggtagaa Protospacer .....****************** **.**. *
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|