Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992465 Staphylococcus aureus isolate 6_LA_232 genome assembly, chromosome: I 11 crisprs NA 2 1 0 0

Results visualization

1. LT992465
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_1 866372-866452 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_2 1077626-1077734 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_3 1976183-1976316 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_4 1979727-1979860 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_5 2004324-2004418 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_6 2048671-2048749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_7 2064048-2064142 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_8 2180474-2180559 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_9 2344434-2344584 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_10 2400003-2400215 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992465_11 2772591-2772673 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 115203-115228 0 1.0
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 870770-870795 1 0.962
LT992465_1 1.1|866397|31|LT992465|CRISPRCasFinder 866397-866427 31 LT992465.1 921266-921296 2 0.935
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 383680-383705 2 0.923
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 821690-821715 2 0.923
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 866625-866650 2 0.923
LT992465_8 8.1|2180504|26|LT992465|CRISPRCasFinder 2180504-2180529 26 LT992465.1 2389078-2389103 2 0.923

1. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 115203-115228, mismatch: 0, identity: 1.0

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
**************************

2. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 870770-870795, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtcagcttctatgttggggccccg	Protospacer
***.**********************

3. spacer 1.1|866397|31|LT992465|CRISPRCasFinder matches to position: 921266-921296, mismatch: 2, identity: 0.935

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

4. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 383680-383705, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagtttctgtgttggggccccg	Protospacer
*******.****.*************

5. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 821690-821715, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccaccagcttctgtgttggggccccg	Protospacer
**.*********.*************

6. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 866625-866650, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgctactatgttggggccccg	Protospacer
***** *** ****************

7. spacer 8.1|2180504|26|LT992465|CRISPRCasFinder matches to position: 2389078-2389103, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttttgtgttggggccccg	Protospacer
**********.*.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992465_10 10.2|2400135|34|LT992465|CRISPRCasFinder 2400135-2400168 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992465_10 10.2|2400135|34|LT992465|CRISPRCasFinder 2400135-2400168 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 10.2|2400135|34|LT992465|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

2. spacer 10.2|2400135|34|LT992465|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage