Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992466 Staphylococcus aureus isolate 4_LA_208 genome assembly, chromosome: I 10 crisprs NA 3 1 0 0

Results visualization

1. LT992466
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_1 513534-513667 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_2 517078-517211 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_3 541675-541769 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_4 586023-586101 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_5 717894-717979 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_6 881872-882022 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_7 937441-937653 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_8 1309075-1309157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_9 2181906-2181986 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992466_10 2393513-2393621 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 1431588-1431613 0 1.0
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 2186304-2186329 1 0.962
LT992466_4 4.1|586046|33|LT992466|CRISPRCasFinder 586046-586078 33 LT992466.1 2742753-2742785 2 0.939
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 926516-926541 2 0.923
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 1700297-1700322 2 0.923
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 2137224-2137249 2 0.923
LT992466_5 5.1|717924|26|LT992466|CRISPRCasFinder 717924-717949 26 LT992466.1 2182159-2182184 2 0.923
LT992466_9 9.1|2181931|31|LT992466|CRISPRCasFinder 2181931-2181961 31 LT992466.1 2236885-2236915 2 0.935

1. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 1431588-1431613, mismatch: 0, identity: 1.0

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
**************************

2. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 2186304-2186329, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtcagcttctatgttggggccccg	Protospacer
***.**********************

3. spacer 4.1|586046|33|LT992466|CRISPRCasFinder matches to position: 2742753-2742785, mismatch: 2, identity: 0.939

cagtagctggcggaaagtcagcttacaataatg	CRISPR spacer
cagaagctggcgaaaagtcagcttacaataatg	Protospacer
*** ********.********************

4. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 926516-926541, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttttgtgttggggccccg	Protospacer
**********.*.*************

5. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 1700297-1700322, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagtttctgtgttggggccccg	Protospacer
*******.****.*************

6. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 2137224-2137249, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccaccagcttctgtgttggggccccg	Protospacer
**.*********.*************

7. spacer 5.1|717924|26|LT992466|CRISPRCasFinder matches to position: 2182159-2182184, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgctactatgttggggccccg	Protospacer
***** *** ****************

8. spacer 9.1|2181931|31|LT992466|CRISPRCasFinder matches to position: 2236885-2236915, mismatch: 2, identity: 0.935

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992466_7 7.2|937573|34|LT992466|CRISPRCasFinder 937573-937606 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992466_7 7.2|937573|34|LT992466|CRISPRCasFinder 937573-937606 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 7.2|937573|34|LT992466|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

2. spacer 7.2|937573|34|LT992466|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage