Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992469 Staphylococcus aureus isolate 15_LA_305 genome assembly, chromosome: I 10 crisprs NA 3 1 0 0

Results visualization

1. LT992469
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_1 75629-75779 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_2 131198-131410 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_3 491871-491953 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_4 1417438-1417518 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_5 1629048-1629156 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_6 2535795-2535928 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_7 2539339-2539472 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_8 2563936-2564030 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_9 2608284-2608362 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992469_10 2740224-2740309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 619599-619624 0 1.0
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 1421836-1421861 1 0.962
LT992469_4 4.1|1417463|31|LT992469|CRISPRCasFinder 1417463-1417493 31 LT992469.1 1472416-1472446 2 0.935
LT992469_9 9.1|2608307|33|LT992469|CRISPRCasFinder 2608307-2608339 33 LT992469.1 1991119-1991151 2 0.939
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 120273-120298 2 0.923
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 935829-935854 2 0.923
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 1372756-1372781 2 0.923
LT992469_10 10.1|2740254|26|LT992469|CRISPRCasFinder 2740254-2740279 26 LT992469.1 1417691-1417716 2 0.923

1. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 619599-619624, mismatch: 0, identity: 1.0

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
**************************

2. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 1421836-1421861, mismatch: 1, identity: 0.962

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgtcagcttctatgttggggccccg	Protospacer
***.**********************

3. spacer 4.1|1417463|31|LT992469|CRISPRCasFinder matches to position: 1472416-1472446, mismatch: 2, identity: 0.935

atcacttatgctttattatgtattggttctt	CRISPR spacer
atcactaatgatttattatgtattggttctt	Protospacer
****** *** ********************

4. spacer 9.1|2608307|33|LT992469|CRISPRCasFinder matches to position: 1991119-1991151, mismatch: 2, identity: 0.939

cagtagctggcggaaagtcagcttacaataatg	CRISPR spacer
cagaagctggcgaaaagtcagcttacaataatg	Protospacer
*** ********.********************

5. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 120273-120298, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagcttttgtgttggggccccg	Protospacer
**********.*.*************

6. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 935829-935854, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgccagtttctgtgttggggccccg	Protospacer
*******.****.*************

7. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 1372756-1372781, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccaccagcttctgtgttggggccccg	Protospacer
**.*********.*************

8. spacer 10.1|2740254|26|LT992469|CRISPRCasFinder matches to position: 1417691-1417716, mismatch: 2, identity: 0.923

ccgccagcttctatgttggggccccg	CRISPR spacer
ccgcctgctactatgttggggccccg	Protospacer
***** *** ****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992469_2 2.2|131330|34|LT992469|CRISPRCasFinder 131330-131363 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992469_2 2.2|131330|34|LT992469|CRISPRCasFinder 131330-131363 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 2.2|131330|34|LT992469|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

2. spacer 2.2|131330|34|LT992469|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tagcactacatcaagacgcatcgtggtaccagca	CRISPR spacer
ttctaccacttcaagacgcatcgtggtattgatc	Protospacer
*  .**.** ******************..... 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage