Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992474 Staphylococcus aureus isolate 19_LA_388 genome assembly, chromosome: I 10 crisprs NA 5 4 0 0

Results visualization

1. LT992474
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_1 317293-317387 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_2 345238-345348 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_3 900755-900954 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_4 1300262-1300370 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_5 1462547-1462629 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_6 1511899-1511979 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_7 2396179-2396261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_8 2484533-2484626 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_9 2767535-2767747 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992474_10 2823166-2823316 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1556831-1556861 0 1.0
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1595662-1595692 0 1.0
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2582282-2582312 0 1.0
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2582392-2582422 0 1.0
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2692788-2692818 0 1.0
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 LT992474.1 2582329-2582354 0 1.0
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 96023-96053 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 141058-141088 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 882767-882797 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 882825-882855 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 882883-882913 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1022447-1022477 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1291729-1291759 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1416230-1416260 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1507492-1507522 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1688628-1688658 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1788926-1788956 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1788980-1789010 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2393716-2393746 1 0.968
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2484494-2484524 1 0.968
LT992474_3 3.1|900786|25|LT992474|CRISPRCasFinder 900786-900810 25 LT992474.1 900955-900979 2 0.92
LT992474_3 3.2|900842|25|LT992474|CRISPRCasFinder 900842-900866 25 LT992474.1 2778609-2778633 2 0.92
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 106771-106801 2 0.935
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 543160-543190 2 0.935
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1471554-1471584 2 0.935
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1511600-1511630 2 0.935
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 1997901-1997931 2 0.935
LT992474_5 5.1|1462573|31|LT992474|CRISPRCasFinder 1462573-1462603 31 LT992474.1 2043991-2044021 2 0.935
LT992474_6 6.1|1511924|31|LT992474|CRISPRCasFinder 1511924-1511954 31 LT992474.1 1456970-1457000 2 0.935

1. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1556831-1556861, mismatch: 0, identity: 1.0

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttggggccc	Protospacer
*******************************

2. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1595662-1595692, mismatch: 0, identity: 1.0

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttggggccc	Protospacer
*******************************

3. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2582282-2582312, mismatch: 0, identity: 1.0

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttggggccc	Protospacer
*******************************

4. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2582392-2582422, mismatch: 0, identity: 1.0

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttggggccc	Protospacer
*******************************

5. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2692788-2692818, mismatch: 0, identity: 1.0

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttggggccc	Protospacer
*******************************

6. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to position: 2582329-2582354, mismatch: 0, identity: 1.0

agaatttcaaaaaagaaattctacag	CRISPR spacer
agaatttcaaaaaagaaattctacag	Protospacer
**************************

7. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 96023-96053, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

8. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 141058-141088, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttctttttgaaattctctgtgttggggccc	Protospacer
********.**********************

9. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 882767-882797, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

10. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 882825-882855, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

11. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 882883-882913, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

12. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1022447-1022477, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctatgttggggccc	Protospacer
*******************.***********

13. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1291729-1291759, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtgttgggcccc	Protospacer
*************************** ***

14. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1416230-1416260, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

15. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1507492-1507522, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctatgttggggccc	Protospacer
*******************.***********

16. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1688628-1688658, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctttgttggggccc	Protospacer
******************* ***********

17. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1788926-1788956, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttctattcgaaattctctgtgttggggccc	Protospacer
***** *************************

18. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1788980-1789010, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttctattcgaaattctctgtgttggggccc	Protospacer
***** *************************

19. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2393716-2393746, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctatgttggggccc	Protospacer
*******************.***********

20. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2484494-2484524, mismatch: 1, identity: 0.968

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttgtcgaaattctctgtgttggggccc	Protospacer
****** ************************

21. spacer 3.1|900786|25|LT992474|CRISPRCasFinder matches to position: 900955-900979, mismatch: 2, identity: 0.92

ggcgaaaatacagcttacaataatg	CRISPR spacer
ggcgaaaagtcagcttacaataatg	Protospacer
********  ***************

22. spacer 3.2|900842|25|LT992474|CRISPRCasFinder matches to position: 2778609-2778633, mismatch: 2, identity: 0.92

ttggaacagcaatttctacagacaa	CRISPR spacer
ttggaacaccaattcctacagacaa	Protospacer
******** *****.**********

23. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 106771-106801, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttctttttgaaattctctatgttggggccc	Protospacer
********.**********.***********

24. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 543160-543190, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaattctctgtattgggggcc	Protospacer
*********************.****** **

25. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1471554-1471584, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcatttcgaaattctctatgttggggccc	Protospacer
**** **************.***********

26. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1511600-1511630, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaatcctctgtgttggggacc	Protospacer
**************.************* **

27. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 1997901-1997931, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcggaattctctgtgttggagccc	Protospacer
**********.***************.****

28. spacer 5.1|1462573|31|LT992474|CRISPRCasFinder matches to position: 2043991-2044021, mismatch: 2, identity: 0.935

tttcttttcgaaattctctgtgttggggccc	CRISPR spacer
tttcttttcgaaaatctctgtgttgaggccc	Protospacer
************* ***********.*****

29. spacer 6.1|1511924|31|LT992474|CRISPRCasFinder matches to position: 1456970-1457000, mismatch: 2, identity: 0.935

aagaaccaatacataataaagcataagtgat	CRISPR spacer
aagaaccaatacataataaatcattagtgat	Protospacer
******************** *** ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992474_3 3.1|900786|25|LT992474|CRISPRCasFinder 900786-900810 25 NC_014792 Enterobacteria phage vB_EcoM-VR7, complete genome 154175-154199 3 0.88
LT992474_3 3.2|900842|25|LT992474|CRISPRCasFinder 900842-900866 25 MW117966 Synechococcus phage S-H9-1, complete genome 42366-42390 4 0.84
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 NZ_CP053838 Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence 17379-17404 4 0.846
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 NZ_CP017210 Borreliella burgdorferi strain B331 plasmid B331_cp9, complete sequence 2023-2048 4 0.846
LT992474_3 3.2|900842|25|LT992474|CRISPRCasFinder 900842-900866 25 NZ_CP038259 Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence 11151-11175 5 0.8
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 NC_008443 Borrelia burgdorferi strain Ip21 plasmid, complete sequence 5652-5677 5 0.808
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 NC_010631 Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence 3460-3485 5 0.808
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 NC_010632 Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence 13739-13764 5 0.808
LT992474_3 3.2|900842|25|LT992474|CRISPRCasFinder 900842-900866 25 NZ_CP047617 Lactococcus raffinolactis strain Lr_19_5 plasmid pLraf_19_5_1, complete sequence 79395-79419 6 0.76
LT992474_8 8.1|2484567|26|LT992474|CRISPRCasFinder 2484567-2484592 26 MK448662 Streptococcus satellite phage Javan97, complete genome 6198-6223 6 0.769
LT992474_9 9.1|2767582|34|LT992474|CRISPRCasFinder 2767582-2767615 34 NC_027332 Acinetobacter phage YMC13/03/R2096, complete genome 68639-68672 11 0.676
LT992474_9 9.1|2767582|34|LT992474|CRISPRCasFinder 2767582-2767615 34 KY000079 Acinetobacter phage AM24, complete genome 74925-74958 11 0.676

1. spacer 3.1|900786|25|LT992474|CRISPRCasFinder matches to NC_014792 (Enterobacteria phage vB_EcoM-VR7, complete genome) position: , mismatch: 3, identity: 0.88

ggcgaaaatacagcttacaataatg	CRISPR spacer
gacgaaaatacatattacaataatg	Protospacer
*.**********  ***********

2. spacer 3.2|900842|25|LT992474|CRISPRCasFinder matches to MW117966 (Synechococcus phage S-H9-1, complete genome) position: , mismatch: 4, identity: 0.84

ttggaacagcaatttctacagacaa	CRISPR spacer
ttggaacagcaatttctactggtat	Protospacer
******************* *..* 

3. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to NZ_CP053838 (Aliiarcobacter faecis strain CCUG 66484 plasmid pAFAEC, complete sequence) position: , mismatch: 4, identity: 0.846

agaatttcaaaaaagaaattctacag	CRISPR spacer
agaatttcaaaaaataaaatctattg	Protospacer
************** *** ****. *

4. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to NZ_CP017210 (Borreliella burgdorferi strain B331 plasmid B331_cp9, complete sequence) position: , mismatch: 4, identity: 0.846

agaatttcaaaaaagaaattctacag	CRISPR spacer
acaatttcaaaaaagaaatattacac	Protospacer
* ***************** .**** 

5. spacer 3.2|900842|25|LT992474|CRISPRCasFinder matches to NZ_CP038259 (Acinetobacter baumannii strain 39741 plasmid pEH_gr13, complete sequence) position: , mismatch: 5, identity: 0.8

ttggaacagcaatttctacagacaa	CRISPR spacer
ctggaacagcaatttctccagaggt	Protospacer
.**************** **** . 

6. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to NC_008443 (Borrelia burgdorferi strain Ip21 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
ccaatttcaaaaaagaaattttccac	Protospacer
  ******************.* ** 

7. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to NC_010631 (Nostoc punctiforme PCC 73102 plasmid pNPUN01, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
tgaatgtcaaaaaagaaattcttgaa	Protospacer
 **** ****************  *.

8. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to NC_010632 (Nostoc punctiforme PCC 73102 plasmid pNPUN02, complete sequence) position: , mismatch: 5, identity: 0.808

agaatttcaaaaaagaaattctacag	CRISPR spacer
tgaatgtcaaaaaagaaattcttgaa	Protospacer
 **** ****************  *.

9. spacer 3.2|900842|25|LT992474|CRISPRCasFinder matches to NZ_CP047617 (Lactococcus raffinolactis strain Lr_19_5 plasmid pLraf_19_5_1, complete sequence) position: , mismatch: 6, identity: 0.76

ttggaacagcaatttctacagacaa	CRISPR spacer
ctggaacagcaatttctacattatc	Protospacer
.*******************     

10. spacer 8.1|2484567|26|LT992474|CRISPRCasFinder matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 6, identity: 0.769

agaatttcaaaaaagaaattctacag	CRISPR spacer
gctttttcaaaaaagaaattctagac	Protospacer
.   ******************* * 

11. spacer 9.1|2767582|34|LT992474|CRISPRCasFinder matches to NC_027332 (Acinetobacter phage YMC13/03/R2096, complete genome) position: , mismatch: 11, identity: 0.676

tgctggtaccacgatgcgtcttgatgtagtgcta	CRISPR spacer
gatcaataccacgatgcgtcttgaagtggtagaa	Protospacer
 .....****************** **.**.  *

12. spacer 9.1|2767582|34|LT992474|CRISPRCasFinder matches to KY000079 (Acinetobacter phage AM24, complete genome) position: , mismatch: 11, identity: 0.676

tgctggtaccacgatgcgtcttgatgtagtgcta	CRISPR spacer
gatcaataccacgatgcgtcttgaagtggtagaa	Protospacer
 .....****************** **.**.  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage