Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
LT992477 | Staphylococcus aureus isolate 22_LA_562 genome assembly, chromosome: I | 11 crisprs | 3 | 1 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_1 | 787062-787142 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_2 | 1001079-1001187 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_3 | 1943155-1943288 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_4 | 1946699-1946832 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_5 | 1971296-1971390 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_6 | 2015644-2015722 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_7 | 2031021-2031115 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_8 | 2147447-2147532 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_9 | 2311422-2311572 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_10 | 2366991-2367203 | Orphan |
NA
|
2 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LT992477_11 | 2744292-2744376 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 25819-25844 | 0 | 1.0 | |
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 791460-791485 | 1 | 0.962 | |
LT992477_1 | 787087-787117 | 31 | LT992477.1 | 843391-843421 | 2 | 0.935 | |
LT992477_6 | 2015667-2015699 | 33 | LT992477.1 | 1417982-1418014 | 2 | 0.939 | |
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 300131-300156 | 2 | 0.923 | |
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 742380-742405 | 2 | 0.923 | |
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 787315-787340 | 2 | 0.923 | |
LT992477_8 | 2147477-2147502 | 26 | LT992477.1 | 2356066-2356091 | 2 | 0.923 |
ccgccagcttctatgttggggccccg CRISPR spacer ccgccagcttctatgttggggccccg Protospacer **************************
ccgccagcttctatgttggggccccg CRISPR spacer ccgtcagcttctatgttggggccccg Protospacer ***.**********************
atcacttatgctttattatgtattggttctt CRISPR spacer atcactaatgatttattatgtattggttctt Protospacer ****** *** ********************
cagtagctggcggaaagtcagcttacaataatg CRISPR spacer cagaagctggcgaaaagtcagcttacaataatg Protospacer *** ********.********************
ccgccagcttctatgttggggccccg CRISPR spacer ccgccagtttctgtgttggggccccg Protospacer *******.****.*************
ccgccagcttctatgttggggccccg CRISPR spacer ccaccagcttctgtgttggggccccg Protospacer **.*********.*************
ccgccagcttctatgttggggccccg CRISPR spacer ccgcctgctactatgttggggccccg Protospacer ***** *** ****************
ccgccagcttctatgttggggccccg CRISPR spacer ccgccagcttttgtgttggggccccg Protospacer **********.*.*************
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
LT992477_10 | 2367123-2367156 | 34 | NC_027332 | Acinetobacter phage YMC13/03/R2096, complete genome | 68639-68672 | 11 | 0.676 | |
LT992477_10 | 2367123-2367156 | 34 | KY000079 | Acinetobacter phage AM24, complete genome | 74925-74958 | 11 | 0.676 |
tagcactacatcaagacgcatcgtggtaccagca CRISPR spacer ttctaccacttcaagacgcatcgtggtattgatc Protospacer * .**.** ******************.....
tagcactacatcaagacgcatcgtggtaccagca CRISPR spacer ttctaccacttcaagacgcatcgtggtattgatc Protospacer * .**.** ******************.....
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|