Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT992487 Vibrio cholerae strain 4295STDY6534216 genome assembly, chromosome: 2 0 crisprs cas3,csa3 0 0 1 0
LT992486 Vibrio cholerae strain 4295STDY6534216 genome assembly, chromosome: 1 1 crisprs cas3,RT,DEDDh,DinG,csx1,csa3,WYL 0 1 5 0

Results visualization

1. LT992487
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 950403 : 996968 58 Shigella_phage(23.08%) tail,transposase,tRNA,integrase attL 975598:975613|attR 1004799:1004814
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LT992486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT992486_1 2660179-2660422 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT992486_1 1.1|2660228|37|LT992486|PILER-CR 2660228-2660264 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
LT992486_1 1.1|2660228|37|LT992486|PILER-CR 2660228-2660264 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|2660228|37|LT992486|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|2660228|37|LT992486|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 647262 : 653879 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1133964 : 1143229 12 Vibrio_phage(62.5%) integrase,transposase attL 1131513:1131526|attR 1148710:1148723
DBSCAN-SWA_3 1465163 : 1507171 41 Vibrio_phage(47.06%) NA NA
DBSCAN-SWA_4 2248935 : 2256128 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_5 2572054 : 2579278 6 uncultured_Mediterranean_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage