Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT993737 Brochothrix thermosphacta isolate CD 337 genome assembly, chromosome: CD337 4 crisprs cas3,WYL,DinG,DEDDh,csa3 0 1 7 0

Results visualization

1. LT993737
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT993737_1 260803-260931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT993737_2 635390-635514 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT993737_4 1353953-1354061 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT993737_5 1441988-1442089 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT993737_2 2.1|635438|29|LT993737|CRISPRCasFinder 635438-635466 29 NZ_CP041067 Bacillus megaterium strain KNU-01 plasmid pKNU_01_3, complete sequence 65135-65163 7 0.759

1. spacer 2.1|635438|29|LT993737|CRISPRCasFinder matches to NZ_CP041067 (Bacillus megaterium strain KNU-01 plasmid pKNU_01_3, complete sequence) position: , mismatch: 7, identity: 0.759

ttcgtcattttaaacattaacataagaaa	CRISPR spacer
actaccattttaaacattaatattagaaa	Protospacer
 ....***************.** *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 31000 : 40789 10 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 411017 : 420510 10 Lactococcus_phage(16.67%) integrase attL 415069:415092|attR 431397:431420
DBSCAN-SWA_3 621962 : 633922 12 Synechococcus_phage(44.44%) NA NA
DBSCAN-SWA_4 1094386 : 1102872 9 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_5 1556464 : 1564944 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_6 1631032 : 1646459 18 Brochothrix_phage(66.67%) tail,holin NA
DBSCAN-SWA_7 1818730 : 1861539 56 Listeria_phage(38.46%) protease,holin,capsid,terminase,integrase attL 1818356:1818377|attR 1860132:1860153
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage