Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LT996886 Tessaracoccus sp. Marseille-P5995 genome assembly, chromosome: contig00001 6 crisprs NA 1 4 0 0

Results visualization

1. LT996886
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_1 125868-126125 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_2 213607-213718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_3 1063402-1064454 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_4 1426353-1426474 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_5 1433532-1433613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LT996886_6 2553585-2553718 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LT996886_1 1.4|126030|18|LT996886|CRT 126030-126047 18 LT996886.1 91707-91724 1 0.944
LT996886_1 1.4|126030|18|LT996886|CRT 126030-126047 18 LT996886.1 341690-341707 2 0.889
LT996886_1 1.4|126030|18|LT996886|CRT 126030-126047 18 LT996886.1 1484436-1484453 2 0.889
LT996886_1 1.4|126030|18|LT996886|CRT 126030-126047 18 LT996886.1 1662726-1662743 2 0.889

1. spacer 1.4|126030|18|LT996886|CRT matches to position: 91707-91724, mismatch: 1, identity: 0.944 

cgccgtcggcttggcggt	CRISPR spacer
cggcgtcggcttggcggt	Protospacer
** ***************

2. spacer 1.4|126030|18|LT996886|CRT matches to position: 341690-341707, mismatch: 2, identity: 0.889 

cgccgtcggcttggcggt	CRISPR spacer
cgccgtcggcatggtggt	Protospacer
********** ***.***

3. spacer 1.4|126030|18|LT996886|CRT matches to position: 1484436-1484453, mismatch: 2, identity: 0.889 

cgccgtcggcttggcggt	CRISPR spacer
cgccgtcggcgtggtggt	Protospacer
********** ***.***

4. spacer 1.4|126030|18|LT996886|CRT matches to position: 1662726-1662743, mismatch: 2, identity: 0.889 

cgccgtcggcttggcggt	CRISPR spacer
cgccgtcgaattggcggt	Protospacer
********. ********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4580433-4580462 5 0.833
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 489715-489744 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 96724-96753 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 94039-94068 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 103678-103707 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 91464-91493 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 441982-442011 6 0.8
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP049837 Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence 66912-66941 7 0.767
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 MH617093 Microviridae sp. isolate cted754, complete genome 354-383 7 0.767
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 395412-395441 7 0.767
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 14829-14858 7 0.767
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 93928-93957 7 0.767
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1061117-1061146 8 0.733
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 712282-712311 8 0.733
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 571294-571323 8 0.733
LT996886_1 1.3|125982|30|LT996886|CRT 125982-126011 30 LC553736 Salmonella phage SAP012 DNA, complete sequence 20612-20641 8 0.733
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MT446400 UNVERIFIED: Escherichia virus TH26, complete genome 12377-12410 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MT446409 UNVERIFIED: Escherichia virus TH37, complete genome 15024-15057 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MH051250 Mycobacterium phage Coog, complete genome 23873-23906 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MH051256 Mycobacterium phage Midas2, complete genome 23873-23906 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NC_041984 Mycobacterium phage Tiger, complete genome 23724-23757 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NC_008738 Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU01, complete sequence 28374-28407 8 0.765
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NC_022086 Mycobacterium phage LittleCherry, complete genome 23825-23858 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MN586016 Mycobacterium phage MarysWell, complete genome 23873-23906 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NC_042312 Mycobacterium virus George, complete genome 23824-23857 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MK305887 Mycobacterium phage HuhtaEnerson15, complete genome 23824-23857 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MN096372 Mycobacterium phage Zolita, complete genome 24086-24119 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1273365-1273398 9 0.735
LT996886_5 5.1|1433556|34|LT996886|CRISPRCasFinder 1433556-1433589 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 433934-433967 9 0.735
LT996886_5 5.1|1433556|34|LT996886|CRISPRCasFinder 1433556-1433589 34 NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 12188-12221 9 0.735
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2155509-2155542 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MG099937 Mycobacterium phage Aragog, complete genome 23933-23966 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MN586062 Mycobacterium phage Lev2, complete genome 23646-23679 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NC_022973 Mycobacterium phage Conspiracy, complete genome 23733-23766 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 KF493882 Mycobacterium phage Jovo, complete genome 24014-24047 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MG099949 Mycobacterium phage Phlorence, complete genome 23933-23966 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MG099944 Mycobacterium phage ForGetIt, complete genome 23758-23791 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 MG099934 Mycobacterium phage AgentM, complete genome 23903-23936 10 0.706
LT996886_4 4.1|1426397|34|LT996886|CRISPRCasFinder 1426397-1426430 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 15410-15443 10 0.706
LT996886_3 3.14|1064384|35|LT996886|CRISPRCasFinder,CRT 1064384-1064418 35 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 318661-318695 11 0.686

1. spacer 1.3|125982|30|LT996886|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833 

agcggt-cggtttcgccgtcggcttggcggt	CRISPR spacer
-gcgctgcggtgtcgccgtcggcgtggcggc	Protospacer
 *** * **** *********** ******.

2. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
cacggtcggtttcaccgtcggcatggcagg	Protospacer
 .***********.******** ****.*

3. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggc-ttggcggt	CRISPR spacer
cgccgtcggattcgccgtcggctttcgtgg-	Protospacer
 ** ***** ************ ** *.**

4. spacer 1.3|125982|30|LT996886|CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggc-ttggcggt	CRISPR spacer
cgccgtcggattcgccgtcggctttcgtgg-	Protospacer
 ** ***** ************ ** *.**

5. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggc-ttggcggt	CRISPR spacer
cgccgtcggattcgccgtcggctttcgtgg-	Protospacer
 ** ***** ************ ** *.**

6. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggc-ttggcggt	CRISPR spacer
cgccgtcggattcgccgtcggctttcgtgg-	Protospacer
 ** ***** ************ ** *.**

7. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 6, identity: 0.8 

agcggtcggtttcgccgtcggc-ttggcggt	CRISPR spacer
cgccgtcggattcgccgtcggctttcgtgg-	Protospacer
 ** ***** ************ ** *.**

8. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP049837 (Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence) position: , mismatch: 7, identity: 0.767 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
agcggtcggtttcgccgttggccgggaccg	Protospacer
******************.***. **

9. spacer 1.3|125982|30|LT996886|CRT matches to MH617093 (Microviridae sp. isolate cted754, complete genome) position: , mismatch: 7, identity: 0.767 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
cgcgggcggtttcgccgtcggctctctgtt	Protospacer
 **** *****************.  .* *

10. spacer 1.3|125982|30|LT996886|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.767 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
ggcggtcggtctcgccgtcggcatagtcga	Protospacer
.*********.*********** *.*. *

11. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
ggcggtcgctttcgccgtcggcatagtcga	Protospacer
.******* ************* *.*. *

12. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.767 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
cccggtcggtttcgccgacggctcgcccgc	Protospacer
  *************** *****.* * *.

13. spacer 1.3|125982|30|LT996886|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
gcctttgcctttcgccgtcgccttggcggt	Protospacer
. *  *   *********** *********

14. spacer 1.3|125982|30|LT996886|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
gcccctgcatttcgccggcggcttggcggt	Protospacer
. *  *  .******** ************

15. spacer 1.3|125982|30|LT996886|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.733 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
gcccctgcatttcgccggcggcttggcggt	Protospacer
. *  *  .******** ************

16. spacer 1.3|125982|30|LT996886|CRT matches to LC553736 (Salmonella phage SAP012 DNA, complete sequence) position: , mismatch: 8, identity: 0.733 

agcggtcggtttcgccgtcggcttggcggt	CRISPR spacer
tccggtcggtttcgccgggggcttgaacat	Protospacer
  ***************  ******.  .*

17. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MT446400 (UNVERIFIED: Escherichia virus TH26, complete genome) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tagcggtggtggttctggtggcggtggtgggcgt	Protospacer
** ************ **********.     **

18. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MT446409 (UNVERIFIED: Escherichia virus TH37, complete genome) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tagcggtggtggttctggtggcggtggtgggcgt	Protospacer
** ************ **********.     **

19. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MH051250 (Mycobacterium phage Coog, complete genome) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggtggctctggtggcggtggagcgtgt	Protospacer
* **********.** **********.. *  **

20. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MH051256 (Mycobacterium phage Midas2, complete genome) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggtggctctggtggcggtggagcgtgt	Protospacer
* **********.** **********.. *  **

21. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NC_041984 (Mycobacterium phage Tiger, complete genome) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggtggctctggtggcggtggagcgtgt	Protospacer
* **********.** **********.. *  **

22. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NC_008738 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU01, complete sequence) position: , mismatch: 8, identity: 0.765 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tggcggtggtggttctggtggtggtgacgatgct	Protospacer
*. ************ *****.*****   ** *

23. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NC_022086 (Mycobacterium phage LittleCherry, complete genome) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggcggttctggtggcggtggagcgtgc	Protospacer
* *******.***** **********.. *  *.

24. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MN586016 (Mycobacterium phage MarysWell, complete genome) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgt	Protospacer
. **********.** **********.. *  **

25. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NC_042312 (Mycobacterium virus George, complete genome) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggcggttctggtggcggtggagcgtgc	Protospacer
* *******.***** **********.. *  *.

26. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MK305887 (Mycobacterium phage HuhtaEnerson15, complete genome) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggcggttctggtggcggtggagcgtgc	Protospacer
* *******.***** **********.. *  *.

27. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MN096372 (Mycobacterium phage Zolita, complete genome) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
tcccggtggcggttctggtggcggtggagcgtgc	Protospacer
* *******.***** **********.. *  *.

28. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
agccggtggtggtgccggtggcggtggcggtggc	Protospacer
 .*********** * **********.   ***.

29. spacer 5.1|1433556|34|LT996886|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctactcaaccgccggtcggggcgcgggggag	CRISPR spacer
cggatcatcaaccggcggccggggcgcgggggca	Protospacer
  * *  ******* ***.************* .

30. spacer 5.1|1433556|34|LT996886|CRISPRCasFinder matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgctactcaaccgccggtcggggcgcgggggag	CRISPR spacer
gcccggtccaactgccggtcggggggcgggggta	Protospacer
** * ...****.*********** ******* .

31. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
cgcgcagcgcggttcgggtggcagtgagccgggt	Protospacer
..*  .  *.************.******* ***

32. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MG099937 (Mycobacterium phage Aragog, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

33. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MN586062 (Mycobacterium phage Lev2, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

34. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NC_022973 (Mycobacterium phage Conspiracy, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

35. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to KF493882 (Mycobacterium phage Jovo, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

36. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MG099949 (Mycobacterium phage Phlorence, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

37. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MG099944 (Mycobacterium phage ForGetIt, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

38. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to MG099934 (Mycobacterium phage AgentM, complete genome) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
ccccggtggtggctctggtggcggtggagcgtgc	Protospacer
. **********.** **********.. *  *.

39. spacer 4.1|1426397|34|LT996886|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706 

taccggtggtggttcgggtggcggtgagcctggt	CRISPR spacer
gcgcgctggtggtgcgggtggcggtgacggtgta	Protospacer
   ** ******* *************   **

40. spacer 3.14|1064384|35|LT996886|CRISPRCasFinder,CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 11, identity: 0.686 

aaggaggcgaaggcggctgcggaagcggaggggaa	CRISPR spacer
tccgaagcgaaggcggctgcggaaacggcccgcgc	Protospacer
   **.******************.***   * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage