Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483310 Staphylococcus aureus strain NCTC9752 genome assembly, chromosome: 1 4 crisprs cas3,DEDDh,DinG,csa3,WYL 3 0 9 0

Results visualization

1. LS483310
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483310_1 100561-100642 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483310_2 704133-704215 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483310_3 750650-750732 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483310_4 793771-793852 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483310_1 1.1|100585|34|LS483310|CRISPRCasFinder 100585-100618 34 LS483310.1 1367826-1367859 0 1.0
LS483310_3 3.1|750675|33|LS483310|CRISPRCasFinder 750675-750707 33 LS483310.1 1367946-1367978 0 1.0
LS483310_3 3.1|750675|33|LS483310|CRISPRCasFinder 750675-750707 33 LS483310.1 1873455-1873487 0 1.0
LS483310_1 1.1|100585|34|LS483310|CRISPRCasFinder 100585-100618 34 LS483310.1 1147383-1147416 1 0.971
LS483310_4 4.1|793795|34|LS483310|CRISPRCasFinder 793795-793828 34 LS483310.1 1367826-1367859 1 0.971
LS483310_1 1.1|100585|34|LS483310|CRISPRCasFinder 100585-100618 34 LS483310.1 1280324-1280357 2 0.941
LS483310_4 4.1|793795|34|LS483310|CRISPRCasFinder 793795-793828 34 LS483310.1 1147383-1147416 2 0.941

1. spacer 1.1|100585|34|LS483310|CRISPRCasFinder matches to position: 1367826-1367859, mismatch: 0, identity: 1.0

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
**********************************

2. spacer 3.1|750675|33|LS483310|CRISPRCasFinder matches to position: 1367946-1367978, mismatch: 0, identity: 1.0

cttttcgaaattctctgtgttggggcccacacc	CRISPR spacer
cttttcgaaattctctgtgttggggcccacacc	Protospacer
*********************************

3. spacer 3.1|750675|33|LS483310|CRISPRCasFinder matches to position: 1873455-1873487, mismatch: 0, identity: 1.0

cttttcgaaattctctgtgttggggcccacacc	CRISPR spacer
cttttcgaaattctctgtgttggggcccacacc	Protospacer
*********************************

4. spacer 1.1|100585|34|LS483310|CRISPRCasFinder matches to position: 1147383-1147416, mismatch: 1, identity: 0.971

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaagttggattcccaat	Protospacer
********************.*************

5. spacer 4.1|793795|34|LS483310|CRISPRCasFinder matches to position: 1367826-1367859, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

6. spacer 1.1|100585|34|LS483310|CRISPRCasFinder matches to position: 1280324-1280357, mismatch: 2, identity: 0.941

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atggagcccaacaaagagaaattggattcccaat	Protospacer
****. ****************************

7. spacer 4.1|793795|34|LS483310|CRISPRCasFinder matches to position: 1147383-1147416, mismatch: 2, identity: 0.941

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaacttctctttgttggggcccat	Protospacer
****.********.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 682297 : 690117 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 702088 : 716818 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 962453 : 970926 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1227268 : 1245217 34 Staphylococcus_phage(54.17%) head,terminase,portal,integrase attL 1220992:1221009|attR 1247208:1247225
DBSCAN-SWA_5 1518452 : 1526782 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_6 1594355 : 1603398 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1728661 : 1797095 67 Staphylococcus_phage(95.83%) tRNA,protease NA
DBSCAN-SWA_8 1883385 : 1973547 106 Staphylococcus_phage(90.91%) tRNA,protease,portal,holin,tail,capsid,head,terminase NA
DBSCAN-SWA_9 1984961 : 1996468 16 uncultured_Caudovirales_phage(41.67%) integrase attL 1980769:1980788|attR 1994490:1994509
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage