Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483317 Staphylococcus aureus strain NCTC5663 genome assembly, chromosome: 1 4 crisprs cas3,DEDDh,DinG,csa3,WYL 1 0 9 1

Results visualization

1. LS483317
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483317_1 1109278-1109368 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483317_2 1265912-1266005 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483317_3 2350009-2350090 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483317_4 2608924-2609009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 1474040-1474065 0 1.0
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 2504105-2504130 1 0.962
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 270767-270792 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 800593-800618 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 800649-800674 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 844711-844736 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 883617-883642 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 977941-977966 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 1193373-1193398 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 1276746-1276771 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 1276802-1276827 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 1678795-1678820 2 0.923
LS483317_4 4.1|2608954|26|LS483317|CRISPRCasFinder 2608954-2608979 26 LS483317.1 2474985-2475010 2 0.923

1. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 1474040-1474065, mismatch: 0, identity: 1.0

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagctactttgttggggccccg	Protospacer
**************************

2. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 2504105-2504130, mismatch: 1, identity: 0.962

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagctactgtgttggggccccg	Protospacer
************ *************

3. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 270767-270792, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
********* ** *************

4. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 800593-800618, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

5. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 800649-800674, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

6. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 844711-844736, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
********* ** *************

7. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 883617-883642, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

8. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 977941-977966, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
********* ** *************

9. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 1193373-1193398, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

10. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 1276746-1276771, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

11. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 1276802-1276827, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

12. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 1678795-1678820, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
********* ** *************

13. spacer 4.1|2608954|26|LS483317|CRISPRCasFinder matches to position: 2474985-2475010, mismatch: 2, identity: 0.923

ccgccagctactttgttggggccccg	CRISPR spacer
ccgccagcttctgtgttggggccccg	Protospacer
********* ** *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 330593 : 372922 71 Staphylococcus_phage(82.86%) terminase,integrase,protease,holin,tail,portal,head,capsid attL 330483:330500|attR 373608:373625
DBSCAN-SWA_2 769425 : 777245 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 789217 : 803736 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 891966 : 938812 73 Staphylococcus_phage(53.52%) terminase,holin,head,tail,capsid NA
DBSCAN-SWA_5 1094517 : 1102990 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1275157 : 1332996 47 Staphylococcus_phage(18.75%) tRNA,protease,transposase NA
DBSCAN-SWA_7 1713468 : 1722511 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1853645 : 1940770 76 Staphylococcus_phage(92.19%) tRNA,bacteriocin,protease,transposase NA
DBSCAN-SWA_9 2074205 : 2110407 41 Staphylococcus_phage(64.0%) terminase,integrase,protease,transposase attL 2071117:2071136|attR 2086168:2086187
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LS483317.1|SQE83499.1|1294098_1294980_+|Translation-elongation-factor-Ts 1294098_1294980_+ 293 aa aa NA HTH_CodY NA 1275157-1332996 yes