Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483322 Streptococcus pyogenes strain NCTC12066 genome assembly, chromosome: 1 2 crisprs DEDDh,cas3,csn2,cas2,cas1,cas9,csm6,DinG,csa3 0 5 7 0

Results visualization

1. LS483322
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483322_1 780820-780920 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483322_2 959228-959527 TypeII II-A
4 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448675 Streptococcus phage Javan129, complete genome 11832-11861 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448771 Streptococcus phage Javan481, complete genome 7778-7807 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448973 Streptococcus phage Javan522, complete genome 9683-9712 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448862 Streptococcus phage Javan178, complete genome 7754-7783 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK449010 Streptococcus phage Javan90, complete genome 10212-10241 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK449012 Streptococcus phage Javan94, complete genome 9223-9252 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448969 Streptococcus phage Javan514, complete genome 10649-10678 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448681 Streptococcus phage Javan141, complete genome 7554-7583 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448972 Streptococcus phage Javan520, complete genome 7703-7732 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448763 Streptococcus phage Javan451, complete genome 8896-8925 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448944 Streptococcus phage Javan452, complete genome 12042-12071 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448849 Streptococcus phage Javan128, complete genome 7527-7556 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448774 Streptococcus phage Javan487, complete genome 7763-7792 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448778 Streptococcus phage Javan493, complete genome 9698-9727 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448773 Streptococcus phage Javan485, complete genome 10649-10678 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448837 Streptococcus phage Javan10, complete genome 9315-9344 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448777 Streptococcus phage Javan491, complete genome 7994-8023 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448845 Streptococcus phage Javan118, complete genome 9506-9535 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448833 Streptococcus phage Javan87, complete genome 10212-10241 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448673 Streptococcus phage Javan119, complete genome 11128-11157 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448767 Streptococcus phage Javan467, complete genome 17217-17246 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448771 Streptococcus phage Javan481, complete genome 16742-16771 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 NC_004586 Streptococcus pyogenes phage 315.3, complete genome 17322-17351 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448969 Streptococcus phage Javan514, complete genome 18465-18494 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448964 Streptococcus phage Javan502, complete genome 17047-17076 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448943 Streptococcus phage Javan450, complete genome 17217-17246 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448972 Streptococcus phage Javan520, complete genome 16590-16619 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448763 Streptococcus phage Javan451, complete genome 17368-17397 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448786 Streptococcus phage Javan509, complete genome 17217-17246 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448774 Streptococcus phage Javan487, complete genome 15578-15607 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448963 Streptococcus phage Javan498, complete genome 12839-12868 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448773 Streptococcus phage Javan485, complete genome 18464-18493 0 1.0
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448777 Streptococcus phage Javan491, complete genome 17250-17279 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448767 Streptococcus phage Javan467, complete genome 17217-17246 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448771 Streptococcus phage Javan481, complete genome 16742-16771 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 NC_004586 Streptococcus pyogenes phage 315.3, complete genome 17322-17351 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448969 Streptococcus phage Javan514, complete genome 18465-18494 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448964 Streptococcus phage Javan502, complete genome 17047-17076 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448943 Streptococcus phage Javan450, complete genome 17217-17246 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448972 Streptococcus phage Javan520, complete genome 16590-16619 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448763 Streptococcus phage Javan451, complete genome 17368-17397 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448786 Streptococcus phage Javan509, complete genome 17217-17246 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448774 Streptococcus phage Javan487, complete genome 15578-15607 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448963 Streptococcus phage Javan498, complete genome 12839-12868 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448773 Streptococcus phage Javan485, complete genome 18464-18493 0 1.0
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448777 Streptococcus phage Javan491, complete genome 17250-17279 0 1.0
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448672 Streptococcus phage Javan117, complete genome 7623-7652 1 0.967
LS483322_2 2.1|959264|30|LS483322|CRISPRCasFinder 959264-959293 30 MK448850 Streptococcus phage Javan132, complete genome 12352-12381 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448685 Streptococcus phage Javan155, complete genome 27333-27362 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448779 Streptococcus phage Javan497, complete genome 31424-31453 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448795 Streptococcus phage Javan527, complete genome 38202-38231 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448944 Streptococcus phage Javan452, complete genome 35236-35265 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448968 Streptococcus phage Javan512, complete genome 31424-31453 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 NC_004584 Streptococcus prophage 315.1, complete genome 31268-31297 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448797 Streptococcus phage Javan531, complete genome 31424-31453 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448854 Streptococcus phage Javan146, complete genome 34274-34303 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448978 Streptococcus phage Javan532, complete genome 31163-31192 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448785 Streptococcus phage Javan507, complete genome 31163-31192 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448853 Streptococcus phage Javan144, complete genome 27333-27362 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 NC_004589 Streptococcus prophage 315.6, complete genome 31521-31550 1 0.967
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448685 Streptococcus phage Javan155, complete genome 17528-17557 1 0.967
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448855 Streptococcus phage Javan150, complete genome 17724-17753 1 0.967
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448853 Streptococcus phage Javan144, complete genome 17528-17557 1 0.967
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448685 Streptococcus phage Javan155, complete genome 17528-17557 1 0.967
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448855 Streptococcus phage Javan150, complete genome 17724-17753 1 0.967
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448853 Streptococcus phage Javan144, complete genome 17528-17557 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448685 Streptococcus phage Javan155, complete genome 27333-27362 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448779 Streptococcus phage Javan497, complete genome 31424-31453 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448795 Streptococcus phage Javan527, complete genome 38202-38231 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448944 Streptococcus phage Javan452, complete genome 35236-35265 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448968 Streptococcus phage Javan512, complete genome 31424-31453 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 NC_004584 Streptococcus prophage 315.1, complete genome 31268-31297 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448797 Streptococcus phage Javan531, complete genome 31424-31453 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448854 Streptococcus phage Javan146, complete genome 34274-34303 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448978 Streptococcus phage Javan532, complete genome 31163-31192 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448785 Streptococcus phage Javan507, complete genome 31163-31192 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448853 Streptococcus phage Javan144, complete genome 27333-27362 1 0.967
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 NC_004589 Streptococcus prophage 315.6, complete genome 31521-31550 1 0.967
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK449012 Streptococcus phage Javan94, complete genome 28235-28264 2 0.933
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448951 Streptococcus phage Javan470, complete genome 31853-31882 2 0.933
LS483322_2 2.2|959330|30|LS483322|CRISPRCasFinder 959330-959359 30 MK448950 Streptococcus phage Javan464, complete genome 32256-32285 2 0.933
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 MK448845 Streptococcus phage Javan118, complete genome 17997-18026 2 0.933
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 MK448845 Streptococcus phage Javan118, complete genome 17997-18026 2 0.933
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK449012 Streptococcus phage Javan94, complete genome 28235-28264 2 0.933
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448951 Streptococcus phage Javan470, complete genome 31853-31882 2 0.933
LS483322_2 2.5|959347|30|LS483322|PILER-CR 959347-959376 30 MK448950 Streptococcus phage Javan464, complete genome 32256-32285 2 0.933
LS483322_2 2.3|959396|30|LS483322|CRISPRCasFinder 959396-959425 30 KY984068 Erwinia phage vB_EamM_Y3, complete genome 117800-117829 7 0.767
LS483322_2 2.4|959462|30|LS483322|CRISPRCasFinder 959462-959491 30 KY984068 Erwinia phage vB_EamM_Y3, complete genome 117800-117829 7 0.767

1. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

2. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

3. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

4. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448862 (Streptococcus phage Javan178, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

5. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

6. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

7. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

8. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448681 (Streptococcus phage Javan141, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

9. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

10. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

11. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

12. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

13. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

14. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

15. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

16. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448837 (Streptococcus phage Javan10, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

17. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

18. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

19. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

20. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 0, identity: 1.0

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttactcta	Protospacer
******************************

21. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448767 (Streptococcus phage Javan467, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

22. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

23. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to NC_004586 (Streptococcus pyogenes phage 315.3, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

24. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

25. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448964 (Streptococcus phage Javan502, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

26. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448943 (Streptococcus phage Javan450, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

27. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

28. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

29. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448786 (Streptococcus phage Javan509, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

30. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

31. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448963 (Streptococcus phage Javan498, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

32. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

33. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

34. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448767 (Streptococcus phage Javan467, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

35. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

36. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to NC_004586 (Streptococcus pyogenes phage 315.3, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

37. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

38. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448964 (Streptococcus phage Javan502, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

39. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448943 (Streptococcus phage Javan450, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

40. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

41. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

42. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448786 (Streptococcus phage Javan509, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

43. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

44. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448963 (Streptococcus phage Javan498, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

45. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

46. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 0, identity: 1.0

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtgatcaat	Protospacer
******************************

47. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 1, identity: 0.967

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttaatcta	Protospacer
************************* ****

48. spacer 2.1|959264|30|LS483322|CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 1, identity: 0.967

ccagagatggcaaagattcggtttactcta	CRISPR spacer
ccagagatggcaaagattcggtttaatcta	Protospacer
************************* ****

49. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448685 (Streptococcus phage Javan155, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

50. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

51. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

52. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

53. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

54. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

55. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

56. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

57. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

58. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

59. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448853 (Streptococcus phage Javan144, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

60. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

61. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448685 (Streptococcus phage Javan155, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

62. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

63. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448853 (Streptococcus phage Javan144, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

64. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448685 (Streptococcus phage Javan155, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

65. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

66. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448853 (Streptococcus phage Javan144, complete genome) position: , mismatch: 1, identity: 0.967

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttggatgttgtggtcaat	Protospacer
************************.*****

67. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448685 (Streptococcus phage Javan155, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

68. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

69. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

70. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

71. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

72. spacer 2.5|959347|30|LS483322|PILER-CR matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

73. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

74. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

75. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

76. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

77. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448853 (Streptococcus phage Javan144, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

78. spacer 2.5|959347|30|LS483322|PILER-CR matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 1, identity: 0.967

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtgggctgtctgac	Protospacer
********************** *******

79. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaatgatttgtgggctgtctgac	Protospacer
*********** ********** *******

80. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtggactgtctgac	Protospacer
********************.* *******

81. spacer 2.2|959330|30|LS483322|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtggactgtctgac	Protospacer
********************.* *******

82. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 2, identity: 0.933

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttgaatgttgtggtcaat	Protospacer
***************.********.*****

83. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 2, identity: 0.933

ataacctaagcgttggatgttgtgatcaat	CRISPR spacer
ataacctaagcgttgaatgttgtggtcaat	Protospacer
***************.********.*****

84. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaatgatttgtgggctgtctgac	Protospacer
*********** ********** *******

85. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtggactgtctgac	Protospacer
********************.* *******

86. spacer 2.5|959347|30|LS483322|PILER-CR matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 2, identity: 0.933

ccatctaaaattatttgtgggcagtctgac	CRISPR spacer
ccatctaaaattatttgtggactgtctgac	Protospacer
********************.* *******

87. spacer 2.3|959396|30|LS483322|CRISPRCasFinder matches to KY984068 (Erwinia phage vB_EamM_Y3, complete genome) position: , mismatch: 7, identity: 0.767

ataaccta---agcgttggatgttgtgatcaat	CRISPR spacer
---gcttacgtggcgttggttgttgtgatcaat	Protospacer
   .*.**   .******* *************

88. spacer 2.4|959462|30|LS483322|CRISPRCasFinder matches to KY984068 (Erwinia phage vB_EamM_Y3, complete genome) position: , mismatch: 7, identity: 0.767

ataaccta---agcgttggatgttgtgatcaat	CRISPR spacer
---gcttacgtggcgttggttgttgtgatcaat	Protospacer
   .*.**   .******* *************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36539 : 48901 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 637000 : 696239 55 Bacillus_phage(18.75%) integrase,transposase,tRNA,protease attL 652692:652708|attR 696815:696831
DBSCAN-SWA_3 718577 : 777363 72 Streptococcus_phage(57.63%) terminase,integrase,tail,holin,portal,transposase,protease attL 722229:722244|attR 779000:779015
DBSCAN-SWA_4 1104153 : 1114756 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_5 1303938 : 1384953 91 Bacillus_phage(16.67%) integrase,bacteriocin,tRNA,transposase,protease attL 1333482:1333499|attR 1345066:1345083
DBSCAN-SWA_6 1393298 : 1399333 8 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 1661713 : 1682167 24 Streptococcus_phage(52.94%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage