Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483331 Streptococcus pyogenes strain NCTC12057 genome assembly, chromosome: 1 2 crisprs DinG,csm6,RT,cas3,DEDDh,csa3 0 1 7 0

Results visualization

1. LS483331
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483331_1 798809-799027 Orphan II-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483331_2 1286382-1286475 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483331_2 2.1|1286409|40|LS483331|CRISPRCasFinder 1286409-1286448 40 MK448679 Streptococcus phage Javan137, complete genome 35066-35105 8 0.8
LS483331_2 2.1|1286409|40|LS483331|CRISPRCasFinder 1286409-1286448 40 MK448950 Streptococcus phage Javan464, complete genome 37224-37263 9 0.775

1. spacer 2.1|1286409|40|LS483331|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 8, identity: 0.8

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
ctagtggctatgcggagttacttatccaaattatcgagga	Protospacer
***************************** * **..    

2. spacer 2.1|1286409|40|LS483331|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 9, identity: 0.775

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
cgagtggctatgcggagttgcttatccaactaatcgagga	Protospacer
* *****************.***********.**..    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36590 : 48950 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 183990 : 205120 24 Shigella_phage(33.33%) transposase,bacteriocin,integrase,tRNA attL 177440:177453|attR 186851:186864
DBSCAN-SWA_3 344865 : 405186 60 Streptococcus_phage(35.0%) transposase,bacteriocin,protease,tRNA NA
DBSCAN-SWA_4 457790 : 464441 13 Streptococcus_phage(66.67%) portal NA
DBSCAN-SWA_5 647559 : 658163 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_6 685109 : 722772 36 Bacillus_phage(23.08%) transposase,head,protease,tRNA NA
DBSCAN-SWA_7 958078 : 1032795 100 Streptococcus_phage(54.41%) portal,integrase,tRNA,tail,terminase,protease attL 991431:991490|attR 1032838:1032933
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage