Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483352 Streptococcus pyogenes strain NCTC12052 genome assembly, chromosome: 1 2 crisprs DinG,csm6,cas9,cas1,cas2,csn2,cas3,DEDDh,csa3 0 2 11 1

Results visualization

1. LS483352
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483352_1 830171-830338 TypeII II-A
2 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483352_2 1008992-1009093 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MK448972 Streptococcus phage Javan520, complete genome 12869-12898 0 1.0
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MK448763 Streptococcus phage Javan451, complete genome 13647-13676 0 1.0
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MK448777 Streptococcus phage Javan491, complete genome 13529-13558 0 1.0
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448944 Streptococcus phage Javan452, complete genome 12352-12381 1 0.967
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448672 Streptococcus phage Javan117, complete genome 7933-7962 1 0.967
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448849 Streptococcus phage Javan128, complete genome 7837-7866 1 0.967
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448850 Streptococcus phage Javan132, complete genome 12662-12691 1 0.967
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MK448845 Streptococcus phage Javan118, complete genome 14951-14980 2 0.933
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448675 Streptococcus phage Javan129, complete genome 12142-12171 2 0.933
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448673 Streptococcus phage Javan119, complete genome 11438-11467 2 0.933
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448845 Streptococcus phage Javan118, complete genome 9816-9845 3 0.9
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448771 Streptococcus phage Javan481, complete genome 8088-8117 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448973 Streptococcus phage Javan522, complete genome 9993-10022 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448775 Streptococcus phage Javan489, complete genome 11977-12006 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448969 Streptococcus phage Javan514, complete genome 10959-10988 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448794 Streptococcus phage Javan525, complete genome 10172-10201 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448972 Streptococcus phage Javan520, complete genome 8013-8042 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448763 Streptococcus phage Javan451, complete genome 9206-9235 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448774 Streptococcus phage Javan487, complete genome 8073-8102 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448778 Streptococcus phage Javan493, complete genome 10008-10037 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448773 Streptococcus phage Javan485, complete genome 10959-10988 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448958 Streptococcus phage Javan486, complete genome 10313-10342 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448777 Streptococcus phage Javan491, complete genome 8304-8333 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448765 Streptococcus phage Javan459, complete genome 10172-10201 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK449010 Streptococcus phage Javan90, complete genome 10522-10551 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 MK448833 Streptococcus phage Javan87, complete genome 10522-10551 4 0.867
LS483352_1 1.2|830273|30|LS483352|CRISPRCasFinder 830273-830302 30 NZ_CP010870 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence 108515-108544 6 0.8
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 NC_014389 Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence 291729-291758 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 JQ692107 Vibrio vulnificus phage SSP002, complete genome 39080-39109 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MN215888 Vibrio phage vB_VpaS_HCMJ, complete genome 39192-39221 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MF754116 Vibrio phage vB_VpaS_KF6, complete genome 37281-37310 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MF754115 Vibrio phage vB_VpaS_KF5, complete genome 39198-39227 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MG602476 Vibrio phage VVP001, complete genome 35844-35873 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 MH925090 UNVERIFIED: Vibrio phage ValLY_3, complete genome 32119-32148 8 0.733
LS483352_1 1.1|830207|30|LS483352|CRISPRCasFinder 830207-830236 30 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 116915-116944 10 0.667

1. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 0, identity: 1.0

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
tcaagagtgagtccagaaccaccagcgaat	Protospacer
******************************

2. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 0, identity: 1.0

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
tcaagagtgagtccagaaccaccagcgaat	Protospacer
******************************

3. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 0, identity: 1.0

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
tcaagagtgagtccagaaccaccagcgaat	Protospacer
******************************

4. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggaacgggat	Protospacer
*.****************************

5. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 1, identity: 0.967

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggaacgggat	Protospacer
*.****************************

6. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 1, identity: 0.967

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggaacgggat	Protospacer
*.****************************

7. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 1, identity: 0.967

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggaacgggat	Protospacer
*.****************************

8. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 2, identity: 0.933

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
tcaagagtgagaccagaaccaccagcaaat	Protospacer
*********** **************.***

9. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 2, identity: 0.933

cactagacatctcaacatctggaacgggat	CRISPR spacer
cactagacatctcaacatctggaacaggtt	Protospacer
*************************.** *

10. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 2, identity: 0.933

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatttcaacatctggaacgggat	Protospacer
*.********.*******************

11. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 3, identity: 0.9

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatttcaacatctggaacgggtt	Protospacer
*.********.***************** *

12. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

13. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

14. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

15. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

16. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

17. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

18. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448763 (Streptococcus phage Javan451, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

19. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

20. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

21. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

22. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448958 (Streptococcus phage Javan486, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

23. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448777 (Streptococcus phage Javan491, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacaggtt	Protospacer
*..**********************.** *

24. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgttagacatctcaacatctggaacagggt	Protospacer
*..**********************.**.*

25. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggtacaggtt	Protospacer
*.******************** **.** *

26. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 4, identity: 0.867

cactagacatctcaacatctggaacgggat	CRISPR spacer
cgctagacatctcaacatctggtacaggtt	Protospacer
*.******************** **.** *

27. spacer 1.2|830273|30|LS483352|CRISPRCasFinder matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 6, identity: 0.8

cactaga----catctcaacatctggaacgggat	CRISPR spacer
----agagttccatctcaagatctggcacgggat	Protospacer
    ***    ******** ****** *******

28. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
tcaagagtcattccagaaccaccaaatgcc	Protospacer
******** * *************.  . .

29. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to JQ692107 (Vibrio vulnificus phage SSP002, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

30. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MN215888 (Vibrio phage vB_VpaS_HCMJ, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

31. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MF754116 (Vibrio phage vB_VpaS_KF6, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

32. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MF754115 (Vibrio phage vB_VpaS_KF5, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

33. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MG602476 (Vibrio phage VVP001, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

34. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to MH925090 (UNVERIFIED: Vibrio phage ValLY_3, complete genome) position: , mismatch: 8, identity: 0.733

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gtaagggtgagtccagaacaaccagacgac	Protospacer
 .***.************* *****  .*.

35. spacer 1.1|830207|30|LS483352|CRISPRCasFinder matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.667

tcaagagtgagtccagaaccaccagcgaat	CRISPR spacer
gttcagccgaatccagaaccaccagcgaag	Protospacer
 .  .. .**.****************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36590 : 48952 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 88112 : 104598 25 Streptococcus_phage(62.5%) integrase,tRNA attL 83484:83498|attR 99475:99489
DBSCAN-SWA_3 338198 : 344232 9 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 352575 : 433522 90 Bacillus_phage(12.5%) transposase,protease,bacteriocin,tRNA NA
DBSCAN-SWA_5 463585 : 501779 39 Streptococcus_phage(25.0%) transposase,portal,tRNA NA
DBSCAN-SWA_6 544530 : 638286 104 Temperate_phage(43.1%) protease,tRNA,tail,head,integrase,holin,terminase,capsid,bacteriocin attL 541212:541229|attR 612722:612739
DBSCAN-SWA_7 673697 : 684301 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_8 711249 : 747603 34 Bacillus_phage(25.0%) transposase,head,protease,tRNA NA
DBSCAN-SWA_9 985508 : 1153043 182 Streptococcus_phage(42.86%) protease,tRNA,tail,portal,integrase,holin,terminase,capsid,transposase attL 1018875:1018934|attR 1157580:1157596
DBSCAN-SWA_10 1177556 : 1217555 61 Streptococcus_phage(68.63%) tail,head,terminase,integrase attL 1179761:1179780|attR 1214940:1214959
DBSCAN-SWA_11 1712595 : 1750870 51 Streptococcus_phage(82.98%) protease,tail,head,portal,integrase,terminase,capsid attL 1716475:1716500|attR 1748157:1748182
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
LS483352.1|SQF52262.1|1021514_1022108_-|phage-protein 1021514_1022108_- 197 aa aa 89 NA NA 985508-1153043 NA