Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483378 Streptococcus sobrinus strain NCTC12279 genome assembly, chromosome: 1 1 crisprs DEDDh,cas3,csa3,RT,DinG 0 1 11 0

Results visualization

1. LS483378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483378_1 171973-172043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483378_1 1.1|171996|25|LS483378|CRISPRCasFinder 171996-172020 25 MH648987 Siphoviridae sp. isolate ctcj11, complete genome 23844-23868 3 0.88

1. spacer 1.1|171996|25|LS483378|CRISPRCasFinder matches to MH648987 (Siphoviridae sp. isolate ctcj11, complete genome) position: , mismatch: 3, identity: 0.88

gagcttgaaaactgggaagcgaggc	CRISPR spacer
gagcttgataactgggaagcgatac	Protospacer
******** ************* .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 184330 : 260664 57 Staphylococcus_phage(14.29%) integrase,transposase,tRNA attL 196761:196775|attR 252537:252551
DBSCAN-SWA_2 315341 : 382470 59 Streptococcus_phage(17.65%) integrase,transposase attL 311187:311205|attR 385604:385622
DBSCAN-SWA_3 422368 : 480370 52 Pandoravirus(15.38%) integrase,protease,transposase,tRNA attL 424390:424405|attR 479245:479260
DBSCAN-SWA_4 500358 : 530995 32 Streptococcus_phage(45.45%) integrase,bacteriocin,transposase attL 515192:515251|attR 531030:531123
DBSCAN-SWA_5 683246 : 744765 54 Tupanvirus(16.67%) protease,bacteriocin,transposase NA
DBSCAN-SWA_6 917329 : 971906 51 Streptococcus_phage(16.67%) holin,bacteriocin,transposase NA
DBSCAN-SWA_7 1265126 : 1272522 8 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_8 1606083 : 1616605 9 Staphylococcus_phage(42.86%) transposase NA
DBSCAN-SWA_9 1759915 : 1797956 39 Staphylococcus_phage(30.77%) integrase,protease,transposase attL 1760546:1760561|attR 1800464:1800479
DBSCAN-SWA_10 1874052 : 1923737 53 Staphylococcus_phage(27.27%) integrase,protease,bacteriocin,tRNA attL 1921979:1922003|attR 1924722:1924746
DBSCAN-SWA_11 2132981 : 2151390 22 Staphylococcus_phage(50.0%) integrase,transposase,tRNA attL 2139220:2139236|attR 2158776:2158792
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage