Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483389 Streptococcus pyogenes strain NCTC10879 genome assembly, chromosome: 1 1 crisprs DEDDh,cas3,cas5,cas8c,cas7,cas4,cas1,cas2,csn2,cas9,csm6,DinG,csa3 0 1 12 0

Results visualization

1. LS483389
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483389_1 569032-569130 TypeI I-C
1 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448792 Streptococcus phage Javan521, complete genome 12481-12517 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 NC_009018 Streptococcus phage phi3396, complete genome 10291-10327 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448679 Streptococcus phage Javan137, complete genome 10676-10712 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 NC_004584 Streptococcus prophage 315.1, complete genome 12076-12112 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448682 Streptococcus phage Javan143, complete genome 12673-12709 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448770 Streptococcus phage Javan477, complete genome 12481-12517 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448978 Streptococcus phage Javan532, complete genome 11971-12007 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448680 Streptococcus phage Javan139, complete genome 11361-11397 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448785 Streptococcus phage Javan507, complete genome 11971-12007 1 0.973
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448769 Streptococcus phage Javan471, complete genome 9781-9817 4 0.892
LS483389_1 1.1|569063|37|LS483389|CRISPRCasFinder 569063-569099 37 MK448684 Streptococcus phage Javan151, complete genome 9781-9817 4 0.892

1. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448792 (Streptococcus phage Javan521, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

2. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to NC_009018 (Streptococcus phage phi3396, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

3. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

4. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

5. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448682 (Streptococcus phage Javan143, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

6. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448770 (Streptococcus phage Javan477, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

7. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

8. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448680 (Streptococcus phage Javan139, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

9. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 1, identity: 0.973

tatccgattttaaccccatattttctacgagataacc	CRISPR spacer
catccgattttaaccccatattttctacgagataacc	Protospacer
.************************************

10. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448769 (Streptococcus phage Javan471, complete genome) position: , mismatch: 4, identity: 0.892

tatccgattttaaccccatattttctacgagataacc-	CRISPR spacer
catccgattttaaccccatattttctacgtg-tagcca	Protospacer
.**************************** * **.** 

11. spacer 1.1|569063|37|LS483389|CRISPRCasFinder matches to MK448684 (Streptococcus phage Javan151, complete genome) position: , mismatch: 4, identity: 0.892

tatccgattttaaccccatattttctacgagataacc-	CRISPR spacer
catccgattttaaccccatattttctacgtg-tagcca	Protospacer
.**************************** * **.** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 30273 : 42634 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 627392 : 707120 96 Streptococcus_phage(59.68%) protease,tail,terminase,head,tRNA,integrase attL 706194:706212|attR 707506:707524
DBSCAN-SWA_3 738921 : 771661 36 Streptococcus_phi-m46.1-like_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_4 778464 : 832376 70 Streptococcus_phage(58.33%) protease,tail,terminase,holin,portal,integrase attL 781830:781889|attR 825960:826055
DBSCAN-SWA_5 1010568 : 1154948 175 Streptococcus_phage(78.07%) protease,tail,terminase,tRNA,capsid,portal,integrase attL 1110419:1110467|attR 1152176:1152224
DBSCAN-SWA_6 1165627 : 1220729 52 Bacillus_virus(23.08%) head,tRNA,protease,transposase NA
DBSCAN-SWA_7 1257096 : 1267699 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_8 1438215 : 1444865 14 Streptococcus_phage(66.67%) portal NA
DBSCAN-SWA_9 1470628 : 1499042 34 Tupanvirus(14.29%) bacteriocin,tRNA,transposase NA
DBSCAN-SWA_10 1537042 : 1546560 8 Streptococcus_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_11 1554897 : 1560932 8 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_12 1856671 : 1867696 16 Streptococcus_phage(76.92%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage