Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483386 Streptococcus pyogenes strain NCTC13742 genome assembly, chromosome: 1 2 crisprs DinG,csm6,RT,cas3,DEDDh,csa3 0 1 8 0

Results visualization

1. LS483386
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483386_1 828928-829146 Orphan II-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483386_2 1322716-1322809 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483386_2 2.1|1322743|40|LS483386|CRISPRCasFinder 1322743-1322782 40 MK448679 Streptococcus phage Javan137, complete genome 35066-35105 8 0.8
LS483386_2 2.1|1322743|40|LS483386|CRISPRCasFinder 1322743-1322782 40 MK448950 Streptococcus phage Javan464, complete genome 37224-37263 9 0.775

1. spacer 2.1|1322743|40|LS483386|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 8, identity: 0.8

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
ctagtggctatgcggagttacttatccaaattatcgagga	Protospacer
***************************** * **..    

2. spacer 2.1|1322743|40|LS483386|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 9, identity: 0.775

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
cgagtggctatgcggagttgcttatccaactaatcgagga	Protospacer
* *****************.***********.**..    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36590 : 48950 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 183917 : 205047 24 Shigella_phage(33.33%) transposase,integrase,tRNA,bacteriocin attL 177367:177380|attR 186778:186791
DBSCAN-SWA_3 344792 : 405114 60 Streptococcus_phage(35.0%) tRNA,transposase,protease,bacteriocin NA
DBSCAN-SWA_4 537419 : 642270 109 Temperate_phage(42.86%) tRNA,transposase,terminase,head,protease,bacteriocin,tail,integrase,capsid attL 534102:534119|attR 616378:616395
DBSCAN-SWA_5 677679 : 688283 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_6 715228 : 752891 36 Bacillus_phage(23.08%) tRNA,transposase,head,protease NA
DBSCAN-SWA_7 987986 : 1063449 96 Streptococcus_phage(58.46%) portal,tRNA,protease,terminase,tail,integrase attL 1021338:1021397|attR 1063492:1063587
DBSCAN-SWA_8 1845933 : 1866158 27 Streptococcus_phage(56.25%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage