Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483409 Streptococcus gallolyticus strain NCTC13773 genome assembly, chromosome: 1 2 crisprs DEDDh,cas3,csa3,csm6,WYL,csn2,cas2,cas1,cas9,DinG 0 7 9 0

Results visualization

1. LS483409
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483409_1 1470806-1470877 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483409_2 1661960-1662387 TypeII II-A
6 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483409_1 1.1|1470829|26|LS483409|CRISPRCasFinder 1470829-1470854 26 MT684590 Streptomyces phage LilMartin, complete genome 116452-116477 5 0.808
LS483409_1 1.1|1470829|26|LS483409|CRISPRCasFinder 1470829-1470854 26 MT897905 Streptomyces phage MulchMansion, complete genome 118086-118111 5 0.808
LS483409_2 2.1|1661996|29|LS483409|CRT 1661996-1662024 29 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 301194-301222 6 0.793
LS483409_2 2.2|1662061|29|LS483409|CRT 1662061-1662089 29 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 301194-301222 6 0.793
LS483409_2 2.3|1662126|29|LS483409|CRT 1662126-1662154 29 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 301194-301222 6 0.793
LS483409_2 2.4|1662191|29|LS483409|CRT 1662191-1662219 29 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 301194-301222 6 0.793
LS483409_2 2.5|1662256|30|LS483409|CRT 1662256-1662285 30 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 412046-412075 6 0.8
LS483409_2 2.5|1662256|30|LS483409|CRT 1662256-1662285 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 9304-9333 6 0.8
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 MN428050 Mycobacterium phage Apex, complete genome 48667-48696 8 0.733
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 MT897910 Mycobacterium phage VioletZ, complete genome 48557-48586 9 0.7
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 MT818419 Mycobacterium phage Lolalove, complete genome 48463-48492 9 0.7
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 MT639648 Mycobacterium phage Heath, complete genome 48069-48098 9 0.7
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 47429-47458 9 0.7
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 NC_011044 Mycobacterium phage Nigel, complete genome 48437-48466 9 0.7
LS483409_2 2.6|1662322|30|LS483409|CRT 1662322-1662351 30 KF493881 Mycobacterium phage JAMaL, complete genome 48621-48650 9 0.7

1. spacer 1.1|1470829|26|LS483409|CRISPRCasFinder matches to MT684590 (Streptomyces phage LilMartin, complete genome) position: , mismatch: 5, identity: 0.808

cgagtcttgaaattaatgaacgagtt	CRISPR spacer
ccagtcttgaaattaatgaacttctc	Protospacer
* *******************   *.

2. spacer 1.1|1470829|26|LS483409|CRISPRCasFinder matches to MT897905 (Streptomyces phage MulchMansion, complete genome) position: , mismatch: 5, identity: 0.808

cgagtcttgaaattaatgaacgagtt	CRISPR spacer
ccagtcttgaaattaatgaacttctc	Protospacer
* *******************   *.

3. spacer 2.1|1661996|29|LS483409|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgttgcgtaaaatgaaaaacaaaca	CRISPR spacer
aatggtttgcgtaaaatgaaaaacagact	Protospacer
**    *******************.** 

4. spacer 2.2|1662061|29|LS483409|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgttgcgtaaaatgaaaaacaaaca	CRISPR spacer
aatggtttgcgtaaaatgaaaaacagact	Protospacer
**    *******************.** 

5. spacer 2.3|1662126|29|LS483409|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgttgcgtaaaatgaaaaacaaaca	CRISPR spacer
aatggtttgcgtaaaatgaaaaacagact	Protospacer
**    *******************.** 

6. spacer 2.4|1662191|29|LS483409|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgttgcgtaaaatgaaaaacaaaca	CRISPR spacer
aatggtttgcgtaaaatgaaaaacagact	Protospacer
**    *******************.** 

7. spacer 2.5|1662256|30|LS483409|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.8

ctgggtcgcaagcacctcgggcttgctgcg	CRISPR spacer
cagtgccgcaagcacctcggccttgttgcc	Protospacer
* * *.************** ****.*** 

8. spacer 2.5|1662256|30|LS483409|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

ctgggtcgcaagcacctcgggcttgctgcg	CRISPR spacer
cagtgccgcaagcacctcggccttgttgcc	Protospacer
* * *.************** ****.*** 

9. spacer 2.6|1662322|30|LS483409|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 8, identity: 0.733

agaccac---cgagtggctgtccaagcagctcg	CRISPR spacer
---ccctgcgcgactggctgtccaagcagctgc	Protospacer
   ** .   *** *****************  

10. spacer 2.6|1662322|30|LS483409|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

11. spacer 2.6|1662322|30|LS483409|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

12. spacer 2.6|1662322|30|LS483409|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

13. spacer 2.6|1662322|30|LS483409|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

14. spacer 2.6|1662322|30|LS483409|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

15. spacer 2.6|1662322|30|LS483409|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.7

agaccaccgagtggctgtccaagcagctcg	CRISPR spacer
cgctgcgcgactggctgtccaagcagctgc	Protospacer
 * .   *** *****************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 244735 : 286136 55 Streptococcus_phage(27.27%) tRNA,transposase,integrase attL 243573:243588|attR 268752:268767
DBSCAN-SWA_2 485456 : 535331 67 Streptococcus_phage(57.45%) head,terminase,integrase,portal attL 483286:483302|attR 535683:535699
DBSCAN-SWA_3 1128415 : 1136957 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 1247301 : 1255909 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_5 1400566 : 1409779 8 Bacillus_phage(37.5%) tRNA NA
DBSCAN-SWA_6 1950939 : 1966836 20 Streptococcus_phage(76.92%) NA NA
DBSCAN-SWA_7 2213751 : 2266627 54 Pseudomonas_phage(28.57%) bacteriocin,protease,transposase NA
DBSCAN-SWA_8 2360912 : 2368780 14 Streptococcus_phage(83.33%) integrase attL 2358786:2358802|attR 2367709:2367725
DBSCAN-SWA_9 2457834 : 2465973 9 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage