Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483414 Streptococcus pyogenes strain NCTC13736 genome assembly, chromosome: 1 1 crisprs DEDDh,cas3,csm6,DinG,csa3 1 0 9 0

Results visualization

1. LS483414
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483414_2 913431-913531 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483414_1 1.2|121662|21|LS483414|PILER-CR 121662-121682 21 LS483414.1 121713-121733 1 0.952

1. spacer 1.2|121662|21|LS483414|PILER-CR matches to position: 121713-121733, mismatch: 1, identity: 0.952

tgcgcttcccccattaatgcc	CRISPR spacer
tgcgcttcctccattaatgcc	Protospacer
*********.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 38856 : 51289 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 623971 : 674307 70 Streptococcus_phage(65.45%) terminase,integrase,portal,tail attL 622102:622117|attR 660974:660989
DBSCAN-SWA_3 739297 : 796544 56 Streptococcus_phage(23.81%) transposase,tRNA,protease,head NA
DBSCAN-SWA_4 846544 : 909974 77 Streptococcus_phage(68.33%) portal,terminase,holin,integrase,tRNA,tail attL 848885:848902|attR 916322:916339
DBSCAN-SWA_5 1115047 : 1172463 75 Streptococcus_phage(58.93%) portal,terminase,integrase,protease,tail attL 1131594:1131609|attR 1177817:1177832
DBSCAN-SWA_6 1219277 : 1247324 22 Streptococcus_phage(85.0%) NA NA
DBSCAN-SWA_7 1293425 : 1393097 113 Temperate_phage(35.82%) capsid,transposase,terminase,holin,integrase,protease,head,tRNA,tail attL 1336160:1336176|attR 1387845:1387861
DBSCAN-SWA_8 1499793 : 1531078 35 Tupanvirus(14.29%) transposase,tRNA,protease,bacteriocin NA
DBSCAN-SWA_9 1579600 : 1585634 9 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage