Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483438 Haemophilus influenzae strain NCTC12975 genome assembly, chromosome: 1 2 crisprs DinG,DEDDh,cas3,WYL 1 0 6 0

Results visualization

1. LS483438
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483438_1 1101439-1101587 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483438_2 1130294-1130381 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483438_3 3.1|1198976|49|LS483438|CRISPRCasFinder 1198976-1199024 49 LS483438.1 1198940-1198988 1 0.98

1. spacer 3.1|1198976|49|LS483438|CRISPRCasFinder matches to position: 1198940-1198988, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 705619 : 712062 7 Staphylococcus_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_2 1231511 : 1288472 75 Mannheimia_phage(48.48%) tRNA,portal,lysis,protease,tail,integrase,capsid,plate,terminase,head,holin attL 1222110:1222126|attR 1291967:1291983
DBSCAN-SWA_3 1373453 : 1385486 11 Acinetobacter_phage(42.86%) tRNA NA
DBSCAN-SWA_4 1394862 : 1426620 48 Haemophilus_phage(18.75%) integrase,terminase attL 1416937:1416953|attR 1432730:1432746
DBSCAN-SWA_5 1664198 : 1672707 8 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_6 1799581 : 1808644 10 Escherichia_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage