1. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP026424 (Acinetobacter sp. ACNIH1 plasmid pACI-148e, complete sequence) position: , mismatch: 3, identity: 0.9
ctat-tattatctaagtattttttatattgt CRISPR spacer
-tatattttatctaattattttttatattgt Protospacer
*** * ******** ***************
2. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP026424 (Acinetobacter sp. ACNIH1 plasmid pACI-148e, complete sequence) position: , mismatch: 3, identity: 0.889
ctat-tattatctaagtattttttatat CRISPR spacer
-tatattttatctaattattttttatat Protospacer
*** * ******** ************
3. spacer 2.33|897420|24|LS991952|PILER-CR matches to MN657126 (Psychrobacter sp. strain ANT_P59 plasmid pA59P3, complete sequence) position: , mismatch: 3, identity: 0.875
ttaaacgatgaattatctcaatca CRISPR spacer
gtaaacgatggattaactcaatca Protospacer
*********.**** ********
4. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP015757 (Clostridium estertheticum subsp. estertheticum strain DSM 8809 plasmid pDSM8809, complete sequence) position: , mismatch: 4, identity: 0.852
ctattattatctaagtattttttatat CRISPR spacer
ctattattatctaaaaattttttatca Protospacer
**************. *********
5. spacer 2.32|897351|27|LS991952|PILER-CR matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 4, identity: 0.852
ctattattatctaagtattttttatat CRISPR spacer
atattattaaataagtattttttatct Protospacer
******** ************** *
6. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_LR214942 (Mycoplasma orale strain NCTC10112 plasmid 3) position: , mismatch: 4, identity: 0.852
-ctattattatctaagtattttttatat CRISPR spacer
ggtagt-ttatctaaatattttttatat Protospacer
** * ********.************
7. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030603 (Staphylococcus aureus strain ER00484.3 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttatatattctttattaact-cgtgt Protospacer
********* ********** ** .* ****
8. spacer 2.20|896756|29|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016596 (Bacillus cereus strain K8 plasmid pBCM301, complete sequence) position: , mismatch: 5, identity: 0.828
tttcattcgatttttttgatgttttcggg CRISPR spacer
tttcaatagatttttttgatgtttcttgg Protospacer
***** * ****************.. **
9. spacer 2.20|896756|29|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010112 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence) position: , mismatch: 5, identity: 0.828
tttcattcgatttttttgatgttttcggg CRISPR spacer
tttcaatagatttttttgatgtttcttgg Protospacer
***** * ****************.. **
10. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP015757 (Clostridium estertheticum subsp. estertheticum strain DSM 8809 plasmid pDSM8809, complete sequence) position: , mismatch: 5, identity: 0.833
ctattattatctaagtattttttat-attgt CRISPR spacer
ctattattatctaaaaattttttatcaacg- Protospacer
**************. ********* * .*
11. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014857 (Lysinibacillus sphaericus III(3)7 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833
ctatta--ttatctaagtattttttatattgt CRISPR spacer
--attagcccatctaagtattttttatgttgt Protospacer
**** ..*****************.****
12. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_010381 (Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence) position: , mismatch: 5, identity: 0.833
ctatta--ttatctaagtattttttatattgt CRISPR spacer
--attagcccatctaagtattttttatgttgt Protospacer
**** ..*****************.****
13. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014644 (Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
ctatta--ttatctaagtattttttatattgt CRISPR spacer
--attagcccatctaagtattttttatgttgt Protospacer
**** ..*****************.****
14. spacer 2.30|897414|30|LS991952|CRISPRCasFinder,CRT matches to MN657126 (Psychrobacter sp. strain ANT_P59 plasmid pA59P3, complete sequence) position: , mismatch: 5, identity: 0.833
aaattaaacgatgaattatctcaatcaatt CRISPR spacer
acagtaaacgatggattaactcaatcaata Protospacer
* * *********.**** **********
15. spacer 2.32|897351|27|LS991952|PILER-CR matches to AP014339 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S37-C34, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gcaaaatcatctaagtattttttatat Protospacer
.* **.*******************
16. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
17. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP054442 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-2, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
18. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP014058 (Staphylococcus saprophyticus strain FDAARGOS_137 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
19. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP014114 (Staphylococcus saprophyticus strain FDAARGOS_168 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
20. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
21. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
22. spacer 2.32|897351|27|LS991952|PILER-CR matches to NC_016643 (Staphylococcus saprophyticus subsp. saprophyticus plasmid pSSAP2, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
23. spacer 2.32|897351|27|LS991952|PILER-CR matches to NC_005207 (Staphylococcus warneri plasmid pPI-1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
ttatttttatctaagtatattttaaaa Protospacer
.**** ************ ***** *
24. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_LR027875 (Staphylococcus aureus strain BPH2056 isolate BPH2056 plasmid 2) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
ttatttttatctaagtatattttaaaa Protospacer
.**** ************ ***** *
25. spacer 2.32|897351|27|LS991952|PILER-CR matches to NC_014369 (Staphylococcus aureus plasmid pSK1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
ttatttttatctaagtatattttaaaa Protospacer
.**** ************ ***** *
26. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
27. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
28. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
cggttattatctcattattttttataa Protospacer
* .********* * ***********
29. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP054435 (Staphylococcus saprophyticus strain UTI-035 plasmid pUTI-035-1, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
30. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP014345 (Campylobacter jejuni strain RM3194 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
31. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
32. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
33. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
34. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
35. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
36. spacer 2.32|897351|27|LS991952|PILER-CR matches to NC_013393 (Staphylococcus epidermidis plasmid pSK105, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
ttatttttatctaagtatattttaaaa Protospacer
.**** ************ ***** *
37. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP017417 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-2, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
38. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
39. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
40. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
41. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP048774 (Campylobacter jejuni strain ZS007 plasmid pCJ3.6K, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
42. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP054446 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-2, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
gaattattatctaaatactttttatct Protospacer
************.**.******* *
43. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
44. spacer 2.32|897351|27|LS991952|PILER-CR matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 5, identity: 0.815
ctattattatctaagtattttttatat CRISPR spacer
taagttttatctaagtattttatatat Protospacer
. * * *************** *****
45. spacer 2.1|895502|30|LS991952|CRISPRCasFinder,CRT matches to MG945400 (UNVERIFIED: Microviridae sp. isolate 3711-1711, complete genome) position: , mismatch: 6, identity: 0.8
taaaccgttatgttttctcaaaattgtaca CRISPR spacer
ttattcattatgttttatcaaacttgtaca Protospacer
* * .*.********* ***** *******
46. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014149 (Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence) position: , mismatch: 6, identity: 0.8
aaaataatggaaaatttaggga---ttaaacat CRISPR spacer
aaaacaattgaaaatttagggatagtcaaa--- Protospacer
****.*** ************* *.***
47. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 6, identity: 0.8
aaaataatggaaaatttagggattaa-acat CRISPR spacer
tcaataatgcaaaatttaggcattagcaca- Protospacer
******* ********** ****. ***
48. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to AY082070 (Bacteriophage phi3626, complete genome) position: , mismatch: 6, identity: 0.8
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
atcatttaattttcttaaatcttctatatg Protospacer
.*** **** **************** *
49. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to NC_003524 (Clostridium phage phi3626, complete genome) position: , mismatch: 6, identity: 0.8
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
atcatttaattttcttaaatcttctatatg Protospacer
.*** **** **************** *
50. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP032824 (Arcobacter cryaerophilus ATCC 43158 plasmid pACRY43158, complete sequence) position: , mismatch: 6, identity: 0.8
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
atcagttaaatttattaattcttcaaaatc Protospacer
.************ **** ***** *. **
51. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016085 (Brachyspira hyodysenteriae ATCC 27164 strain B-78 plasmid pBhyoB78, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ttaattttaaataatctttaatattttcgat Protospacer
** ********* ************.**
52. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg CRISPR spacer
cttctttaaaatattctttagtattatggtg Protospacer
.****** ************.**** . ***
53. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
54. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg CRISPR spacer
cttctttaaaatattctttagtattatggtg Protospacer
.****** ************.**** . ***
55. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg CRISPR spacer
cttctttaaaatattctttagtattatggtg Protospacer
.****** ************.**** . ***
56. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014850 (Bacillus thuringiensis strain HD12 plasmid pHD120039, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatt-tccgtg CRISPR spacer
cttcttttaaatactctttaatgttattcat- Protospacer
.************.********.** *.*.*
57. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040335 (Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttagatattctttaat-ttgttgtat Protospacer
*********.************ ** ..**.
58. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_016851 (Aliivibrio fischeri strain KB1A-97 plasmid pKB1A97-67, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatat-ttccgtg CRISPR spacer
tttcttttaaatattcatttatatattttat- Protospacer
**************** ** **** **...*
59. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg CRISPR spacer
cttctttaaaatattctttagtattatggtg Protospacer
.****** ************.**** . ***
60. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KT967075 (Bacillus phage phi4I1, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
61. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KT372714 (Bacillus phage vB_BtS_BMBtp16, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
62. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_023599 (Bacillus phage phiCM3, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
63. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MG710484 (Bacillus phage BtiUFT6.51-F, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
64. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_018085 (Bacillus phage BtCS33, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
tttcttttaaatattctttgat-ttgttgtat Protospacer
*******************.** ** ..**.
65. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
gctcttttaaaaattctttaat-tttaggtga Protospacer
.********* ********** *** ***
66. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN692972 (Marine virus AFVG_117M68, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaat---atttccgtg CRISPR spacer
tttctattaaattttctttaatagcattccc--- Protospacer
***** ****** ********* ***.**
67. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693697 (Marine virus AFVG_250M256, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaat---atttccgtg CRISPR spacer
tttctattaaattttctttaatagcattccc--- Protospacer
***** ****** ********* ***.**
68. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694164 (Marine virus AFVG_250M1189, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaatatttccgtg--- CRISPR spacer
gttctgttatatattctttaatat---cgtgtga Protospacer
**** *** ************** ****
69. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694054 (Marine virus AFVG_250M255, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaat---atttccgtg CRISPR spacer
tttctattaaattttctttaatagcattccc--- Protospacer
***** ****** ********* ***.**
70. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694075 (Marine virus AFVG_250M257, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaat---atttccgtg CRISPR spacer
tttctattaaattttctttaatagcattccc--- Protospacer
***** ****** ********* ***.**
71. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693016 (Marine virus AFVG_117M69, complete genome) position: , mismatch: 6, identity: 0.806
tttcttttaaatattctttaat---atttccgtg CRISPR spacer
tttctattaaattttctttaatagcattccc--- Protospacer
***** ****** ********* ***.**
72. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694774 (Marine virus AFVG_250M941, complete genome) position: , mismatch: 6, identity: 0.8
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaataatggagaatttatgaaagagaaa Protospacer
************.****** *** *.* *
73. spacer 2.8|895965|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK448864 (Streptococcus phage Javan180, complete genome) position: , mismatch: 6, identity: 0.8
atttttgatttcaagaaactaatatcacgc CRISPR spacer
attttttatttaaagaaactaatcttaatc Protospacer
****** **** *********** *.* *
74. spacer 2.12|896228|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693406 (Marine virus AFVG_25M259, complete genome) position: , mismatch: 6, identity: 0.8
cgttttgatagaaatcttgatcaaatattg CRISPR spacer
ctgtttgataaatatcttgatcaaattctg Protospacer
* *******.* ************* .**
75. spacer 2.15|896426|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtagttattataacacaaa Protospacer
** .*********** ********* **
76. spacer 2.15|896426|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtagttattataacacaaa Protospacer
** .*********** ********* **
77. spacer 2.15|896426|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MH319752 (Marine virus AG-345-F15 Ga0172271_14 genomic sequence) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtatcaattataacagagt Protospacer
** .********* .************.*
78. spacer 2.16|896492|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 6, identity: 0.8
gttatttttcaataaactaatctattgtat CRISPR spacer
gatatttttcaataaaattatctatttctt Protospacer
* ************** * ******* . *
79. spacer 2.17|896558|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AY939844 (Prochlorococcus phage P-SSM2, complete genome) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtagttattataacacaaa Protospacer
** .*********** ********* **
80. spacer 2.17|896558|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to HQ632825 (Prochlorococcus phage P-SSM5 genomic sequence) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtagttattataacacaaa Protospacer
** .*********** ********* **
81. spacer 2.17|896558|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MH319752 (Marine virus AG-345-F15 Ga0172271_14 genomic sequence) position: , mismatch: 6, identity: 0.8
aactctatttagtagtaattataacagaat CRISPR spacer
aaaattatttagtatcaattataacagagt Protospacer
** .********* .************.*
82. spacer 2.18|896624|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX258624 (Bacillus thuringiensis strain INTA Fr7-4 plasmid pFR260, complete sequence) position: , mismatch: 6, identity: 0.8
gttatttttcaataaactaatctattgtat CRISPR spacer
gatatttttcaataaaattatctatttctt Protospacer
* ************** * ******* . *
83. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 6, identity: 0.8
tttgcgtg---ataattatgttggtattgaaaa CRISPR spacer
---gcgcggatataattatgttggtaatgaaac Protospacer
***.* *************** *****
84. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to AP014339 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S37-C34, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8
ctattattatctaagtattttttatattgt CRISPR spacer
gcaaaatcatctaagtattttttatattgc Protospacer
.* **.*********************.
85. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_LR214942 (Mycoplasma orale strain NCTC10112 plasmid 3) position: , mismatch: 6, identity: 0.8
-ctattattatctaagtattttttatattgt CRISPR spacer
ggtagt-ttatctaaatattttttatattta Protospacer
** * ********.*************
86. spacer 2.30|897414|30|LS991952|CRISPRCasFinder,CRT matches to NC_003042 (Clostridium perfringens str. 13 plasmid pCP13, complete sequence) position: , mismatch: 6, identity: 0.8
aaattaaacgatgaattatctcaatcaatt CRISPR spacer
acatgggatgatgaattatcacaatcaatt Protospacer
* ** ..*.*********** *********
87. spacer 2.32|897351|27|LS991952|PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
ctattattatctaagtattttttatat CRISPR spacer
tgattattatcaaagtattttatatgg Protospacer
. ********* ********* ***.
88. spacer 2.32|897351|27|LS991952|PILER-CR matches to MK448707 (Streptococcus phage Javan227, complete genome) position: , mismatch: 6, identity: 0.778
ctattattatctaagtattttttatat CRISPR spacer
ttattattatctaaatatttttcaatc Protospacer
.*************.*******.* .
89. spacer 2.32|897351|27|LS991952|PILER-CR matches to MT774410 (CrAssphage cr272_1, complete genome) position: , mismatch: 6, identity: 0.778
ctattattatctaagtattttttatat CRISPR spacer
ctattattatcttagtaattttttctg Protospacer
************ **** ***** .
90. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
aaaataatggaaaatttagggattaaacat CRISPR spacer
gtgataatggaaaatttacggatttaactg Protospacer
. .*************** ***** ***
91. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.767
aaaataatggaaaatttagggattaaacat CRISPR spacer
ttaaatatggaaaattgagggataaaacaa Protospacer
** ********** ****** *****
92. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP033461 (Brevibacillus laterosporus strain 1821L plasmid p1821L01, complete sequence) position: , mismatch: 7, identity: 0.767
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
aagggttaaatttctttaatctactagttt Protospacer
. .************ ***** ******.
93. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to KX077890 (Streptococcus phage phiLP081102, complete genome) position: , mismatch: 7, identity: 0.767
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
gcctgttaaagtttttaaatcttctagcat Protospacer
*.* ****** **.*************. .
94. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to KX077895 (Streptococcus phage phiZJ20091101-4, complete genome) position: , mismatch: 7, identity: 0.767
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
gcctgttaaagtttttaaatcttctagcat Protospacer
*.* ****** **.*************. .
95. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to KC413987 (Streptococcus phage phiSS12, complete genome) position: , mismatch: 7, identity: 0.767
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
gcctgttaaagtttttaaatcttctagcat Protospacer
*.* ****** **.*************. .
96. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to MK721183 (Enterococcus phage vB_EfaP_Ef7.2, complete genome) position: , mismatch: 7, identity: 0.767
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
taaagtcttatatcttaaatcttctagttc Protospacer
***. ** ******************
97. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcatttaaatattctttaacatttataga Protospacer
**** ****************.**** .. .
98. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_011775 (Bacillus cereus G9842 plasmid pG9842_209, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcatttaaatattctttaacatttataga Protospacer
**** ****************.**** .. .
99. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK064565 (Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attcttttaaattttcttcaatatttcttaa Protospacer
*********** *****.********. .
100. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KF831355 (Staphylococcus aureus strain A960649 plasmid pBU108a, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
101. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
102. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
103. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
104. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
105. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
106. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
107. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
108. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
109. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
110. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
attttcttaaatattctttaatatttgctaa Protospacer
**.*.******************** * .
111. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
aattttttaattattttttaatatttccatt Protospacer
*.****** ****.************.*
112. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
113. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
114. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
115. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
116. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
117. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
118. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
119. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019601 (Brachyspira hyodysenteriae strain BH718 plasmid pBH718, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ttaattttaaataatctttaatattttcaat Protospacer
** ********* ************.*.
120. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttgtatttttctt Protospacer
* ***************** .*****.. *
121. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcctttaaatattcttcaatatcatcagg Protospacer
****.*************.*****. .*. *
122. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_012226 (Brachyspira hyodysenteriae WA1 plasmid pBHWA1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ttaattttaaataatctttaatattttcaat Protospacer
** ********* ************.*.
123. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042347 (Staphylococcus aureus strain BSN9S plasmid pSaBSN9, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
124. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044538 (Borrelia sp. CA690 plasmid lp28-2, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ttgtttttgaatattatttaatatttctttt Protospacer
** .****.****** ***********. *
125. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
126. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030569 (Staphylococcus aureus strain ER01892.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
127. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030458 (Staphylococcus aureus strain ER04013.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
128. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017923 (Staphylococcus aureus strain JP02758 plasmid pJP080, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
129. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_013325 (Staphylococcus aureus plasmid pWBG745, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
130. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030696 (Staphylococcus aureus strain ER01532.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
131. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030620 (Staphylococcus aureus strain ER01524.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
132. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030710 (Staphylococcus aureus strain ER01174.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
133. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012757 (Staphylococcus aureus subsp. aureus strain JS395 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
134. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030674 (Staphylococcus aureus strain ER01533.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
135. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030482 (Staphylococcus aureus strain ER03913.3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
136. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to CP030679 (Staphylococcus aureus strain ER00573.3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
137. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012594 (Staphylococcus aureus strain HOU1444-VR plasmid pVR-MSSA_01, complete sequence) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatattctttattaactcattt Protospacer
********* ********** ** .** *
138. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttcttctaaatattctttaacatatacatt Protospacer
*****.**************.** * *.*
139. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694164 (Marine virus AFVG_250M1189, complete genome) position: , mismatch: 7, identity: 0.774
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttctcttaaaaattctttaatagctacagg Protospacer
*****.***** *********** .* *. *
140. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013499 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S39-C84) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
141. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694496 (Marine virus AFVG_250M65, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
142. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694183 (Marine virus AFVG_250M64, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
143. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013497 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
144. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013498 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
145. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694301 (Marine virus AFVG_250M69, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
146. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693775 (Marine virus AFVG_250M63, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
147. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013379 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C43) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aatgataatggaaaagttgggaatcaatga Protospacer
* .*********** **.******** *
148. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013776 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S36-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
149. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013496 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S28-C61) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
150. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694685 (Marine virus AFVG_250M68, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
151. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013775 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaactaatggaaaatttaagaagaaattc Protospacer
**** **************.*** ** .
152. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694064 (Marine virus AFVG_250M67, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
153. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693661 (Marine virus AFVG_250M62, complete genome) position: , mismatch: 7, identity: 0.767
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
aaaaataatggaaaaattagtaatggaatt Protospacer
************** **** *** .**.
154. spacer 2.7|895899|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ttagactttcgcgacgatctgattaacggt CRISPR spacer
tccgactttcgcgacgatctggttgccact Protospacer
*. ******************.**. *. *
155. spacer 2.8|895965|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 7, identity: 0.767
atttttgatttcaagaaactaa----tatcacgc CRISPR spacer
gtttttgatttcaataaactaagggttatt---- Protospacer
.************* ******* ***.
156. spacer 2.8|895965|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MF417868 (Uncultured Caudovirales phage clone 7AX_1, partial genome) position: , mismatch: 7, identity: 0.767
atttttgatttcaagaaactaatatcacgc CRISPR spacer
ttatttgctttcaagaaagtaatatcttga Protospacer
* **** ********** ******* .*
157. spacer 2.8|895965|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MH321490 (Staphylococcus phage Quidividi, complete genome) position: , mismatch: 7, identity: 0.767
atttttgatttcaagaaactaatatcacgc CRISPR spacer
ttatttgctttcaagaaagtaatatcttga Protospacer
* **** ********** ******* .*
158. spacer 2.8|895965|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MH321491 (Staphylococcus phage Twillingate, complete genome) position: , mismatch: 7, identity: 0.767
atttttgatttcaagaaactaatatcacgc CRISPR spacer
ttatttgctttcaagaaagtaatatcttga Protospacer
* **** ********** ******* .*
159. spacer 2.13|896294|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012100 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-1, complete sequence) position: , mismatch: 7, identity: 0.767
ttaaaaagtgaattttgatctccgtttttt CRISPR spacer
atctcatctgaattttgatctgcgtttttt Protospacer
* * ************* ********
160. spacer 2.13|896294|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 7, identity: 0.767
ttaaaaagtgaattttgatctccgtttttt CRISPR spacer
atctcatctgaattttgatctgcgtttttt Protospacer
* * ************* ********
161. spacer 2.16|896492|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 7, identity: 0.767
gttatttttcaataaactaatctattgtat CRISPR spacer
actgtttttcattaaaccaatctattgcac Protospacer
..*.******* *****.*********.*.
162. spacer 2.18|896624|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 7, identity: 0.767
gttatttttcaataaactaatctattgtat CRISPR spacer
actgtttttcattaaaccaatctattgcac Protospacer
..*.******* *****.*********.*.
163. spacer 2.19|896690|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
agttaataagtaactcatctataccacaaa CRISPR spacer
aaaccataagtaacacatatataccacata Protospacer
*. . ********* *** ********* *
164. spacer 2.20|896756|29|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 7, identity: 0.759
tttcattcgatttttttgatgttttcggg CRISPR spacer
aagaattcgatttctttgatgatttcggt Protospacer
*********.******* ******
165. spacer 2.20|896756|29|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023191 (Acetobacter pomorum strain SH plasmid pSH2, complete sequence) position: , mismatch: 7, identity: 0.759
tttcattcgatttttttgatgttttcggg CRISPR spacer
tctcattcgattttttgggtgttttttct Protospacer
*.************** *.******.
166. spacer 2.20|896756|29|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to HQ316582 (Vibrio phage henriette 12B8, complete genome) position: , mismatch: 7, identity: 0.759
tttcattcgatttttttgatgttttcggg CRISPR spacer
tctttatcgatttttttgatgttatcgtc Protospacer
*.*. ***************** ***
167. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054365 (Escherichia coli strain SCU-171 plasmid pSCU-171-2, complete sequence) position: , mismatch: 7, identity: 0.767
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
tgggcttgataattatgttgttattgatcg Protospacer
* ** ************** ****** .
168. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045281 (Escherichia coli strain LAU-OXA plasmid pLAU-OXA4, complete sequence) position: , mismatch: 7, identity: 0.767
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
tgggcttgataattatgttgttattgatcg Protospacer
* ** ************** ****** .
169. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040266 (Escherichia coli strain 631 plasmid pEc631_3, complete sequence) position: , mismatch: 7, identity: 0.767
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
tgggcttgataattatgttgttattgatcg Protospacer
* ** ************** ****** .
170. spacer 2.27|897216|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to LC557520 (Staphylococcus phage vB_SsapH-Golestan101-M DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgatttaccaaacgaactcaaacctatcga CRISPR spacer
aagatgatcaaacgaactaaaacctatcga Protospacer
.. * *.********** ***********
171. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
atattattaaataagtattttttatctgaa Protospacer
******** ************** * .
172. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_005207 (Staphylococcus warneri plasmid pPI-1, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
ttatttttatctaagtatattttaaaaatt Protospacer
.**** ************ ***** * *
173. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_LR027875 (Staphylococcus aureus strain BPH2056 isolate BPH2056 plasmid 2) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
ttatttttatctaagtatattttaaaaatt Protospacer
.**** ************ ***** * *
174. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_014369 (Staphylococcus aureus plasmid pSK1, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
ttatttttatctaagtatattttaaaaatt Protospacer
.**** ************ ***** * *
175. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
cggttattatctcattattttttataatca Protospacer
* .********* * *********** *
176. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_013393 (Staphylococcus epidermidis plasmid pSK105, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
ttatttttatctaagtatattttaaaaatt Protospacer
.**** ************ ***** * *
177. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP010910 (Candidatus Pantoea carbekii strain US plasmid pBMSBPS3, complete sequence) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
tttagagtatctaattatattttatattgt Protospacer
.* * ******* *** ***********
178. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_AP018283 (Chondrocystis sp. NIES-4102 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
ctattattatctaagtattttttatattgt CRISPR spacer
ataaaattatcttaatattttttatattag Protospacer
** ******* *.*************.
179. spacer 2.30|897414|30|LS991952|CRISPRCasFinder,CRT matches to MG198570 (Lake Baikal phage Baikal-20-5m-C28, complete genome) position: , mismatch: 7, identity: 0.767
aaattaaacgatgaattatctcaatcaatt CRISPR spacer
aaattacaagatgaattatctcaagtagaa Protospacer
****** * *************** .*.
180. spacer 2.30|897414|30|LS991952|CRISPRCasFinder,CRT matches to MN856072 (Bacteriophage sp. isolate 247, complete genome) position: , mismatch: 7, identity: 0.767
aaattaaacgatgaattatctcaatcaatt CRISPR spacer
ataacgagcgatgaaatatctcaatcaata Protospacer
* * ..*.******* *************
181. spacer 2.30|897414|30|LS991952|CRISPRCasFinder,CRT matches to MH220877 (Oenococcus phage phiOE33PA, complete genome) position: , mismatch: 7, identity: 0.767
aaattaa--acgatgaattatctcaatcaatt CRISPR spacer
--tccaaccacgatgaattaaatcaatcaatt Protospacer
..** *********** **********
182. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP013205 (Paenibacillus sp. IHB B 3084 plasmid pHD02, complete sequence) position: , mismatch: 8, identity: 0.733
aaaataatggaaaatttagggattaaacat CRISPR spacer
agcactctggaaaattcagggattaaacta Protospacer
*. *. *********.***********
183. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aaaataatggaaaatttagggattaaacat CRISPR spacer
tttataatggaaaatttaaggaataattac Protospacer
***************.*** *** .*.
184. spacer 2.2|895568|30|LS991952|CRISPRCasFinder,CRT matches to MT584805 (Bacillus phage Tomato, complete genome) position: , mismatch: 8, identity: 0.733
aaaataatggaaaatttagggattaaacat CRISPR spacer
gcatcgttcgaaaagttagggattaaacat Protospacer
. * .. * ***** ***************
185. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
186. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
187. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
188. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN855637 (Bacteriophage sp. isolate 32, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttctttaaaatattctttaatagaatcaat Protospacer
******* *************** .*.
189. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
190. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MT366947 (Bacillus phage Hyb2phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gatcttttcaatactctttaatattttattt Protospacer
****** ****.************. *
191. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694619 (Marine virus AFVG_250M660, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gtatttttaaatattctttaatacttttctt Protospacer
* .*******************.**.. *
192. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KY030782 (Bacillus phage phi3T, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gatcttttcaatactctttaatattttattt Protospacer
****** ****.************. *
193. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694158 (Marine virus AFVG_250M128, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttttaaatattcttttatataagggaa Protospacer
* ***************** **** * .
194. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693646 (Marine virus AFVG_250M659, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gtatttttaaatattctttaatacttttctt Protospacer
* .*******************.**.. *
195. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MT366946 (Bacillus phage Hyb1phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gatcttttcaatactctttaatattttattt Protospacer
****** ****.************. *
196. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MT366948 (Bacillus phage Hyb3phi3Ts-SPbeta, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gatcttttcaatactctttaatattttattt Protospacer
****** ****.************. *
197. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694157 (Marine virus AFVG_250M658, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gtatttttaaatattctttaatacttttctt Protospacer
* .*******************.**.. *
198. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MT366945 (Bacillus phage phi3Ts, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gatcttttcaatactctttaatattttattt Protospacer
****** ****.************. *
199. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
aattatttaattattttttaatatttccatt Protospacer
*. ***** ****.************.*
200. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015354 (Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tattttttaaaaattcttttatatttcgcac Protospacer
* *.******* ******* *******
201. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010578 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB232, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
attcttttaaatattatataata-tgctatat Protospacer
************** * ***** * *..*.
202. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010582 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB51, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg- CRISPR spacer
attcttttaaatattatataata-tgctatat Protospacer
************** * ***** * *..*.
203. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053977 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttaaagattctttagtaccacggca Protospacer
*********** ********.**.. * *..
204. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009332 (Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttaaagattctttagtaccacggca Protospacer
*********** ********.**.. * *..
205. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KT895374 (Bacillus phage vB_BpuM-BpSp, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatcttctttaatagacatctg Protospacer
********* ** ********** . . **
206. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
207. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 8, identity: 0.742
tttcttttaaatattcttt-------aatatttccgtg CRISPR spacer
tttcttttaaataatcttttataaaaaatat------- Protospacer
************* ***** *****
208. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaatgatggaaaatttaggagatgtagg Protospacer
******.***************. .. * .
209. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaatgatggaaaatttaggagatgtagg Protospacer
******.***************. .. * .
210. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaatgatggaaaatttaggagatgtagg Protospacer
******.***************. .. * .
211. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694758 (Marine virus AFVG_250M853, complete genome) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaataatggagaatttatgaattgttat Protospacer
************.****** ****..
212. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN693989 (Marine virus AFVG_250M851, complete genome) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaataatggagaatttatgaattgttat Protospacer
************.****** ****..
213. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN694077 (Marine virus AFVG_250M852, complete genome) position: , mismatch: 8, identity: 0.733
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
taaaataatggagaatttatgaattgttat Protospacer
************.****** ****..
214. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
215. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
216. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
217. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045340 (Vibrio sp. THAF190c plasmid pTHAF190c_b, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
ccgaacaaaattggcaacttttagtgcaac Protospacer
..***** ************* *** .* .
218. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
219. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
220. spacer 2.10|896096|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.733
ttgaacacaattggcaactttaagtttatt CRISPR spacer
tatattttaattggcaattttaagtttata Protospacer
* * . .*********.***********
221. spacer 2.12|896228|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021643 (Campylobacter concisus strain P2CDO4 plasmid pICON, complete sequence) position: , mismatch: 8, identity: 0.733
cgttttgatagaaatcttgatcaaatattg CRISPR spacer
aaagatgatagaaatcttaatcaaataatt Protospacer
. *************.******** *
222. spacer 2.14|896360|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016869 (Legionella pneumophila subsp. pneumophila strain FFI102 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tcattaaaacgagaatatttagttcataaa CRISPR spacer
tatctaaaaagagaatattaagttcatttt Protospacer
* .***** ********* *******
223. spacer 2.14|896360|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016871 (Legionella pneumophila subsp. pneumophila strain FFI103 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tcattaaaacgagaatatttagttcataaa CRISPR spacer
tatctaaaaagagaatattaagttcatttt Protospacer
* .***** ********* *******
224. spacer 2.14|896360|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016875 (Legionella pneumophila subsp. pneumophila strain FFI329 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tcattaaaacgagaatatttagttcataaa CRISPR spacer
tatctaaaaagagaatattaagttcatttt Protospacer
* .***** ********* *******
225. spacer 2.16|896492|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049297 (Bacillus megaterium strain S188 plasmid pS188, complete sequence) position: , mismatch: 8, identity: 0.733
gttatttttcaataaactaatctattgtat CRISPR spacer
taaacaattaaacaaactaatctattgtat Protospacer
*. ** **.*****************
226. spacer 2.18|896624|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049297 (Bacillus megaterium strain S188 plasmid pS188, complete sequence) position: , mismatch: 8, identity: 0.733
gttatttttcaataaactaatctattgtat CRISPR spacer
taaacaattaaacaaactaatctattgtat Protospacer
*. ** **.*****************
227. spacer 2.19|896690|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ776585 (Clostridium botulinum strain DB2 plasmid pDB2, complete sequence) position: , mismatch: 8, identity: 0.733
agttaataagtaactcatctataccacaaa CRISPR spacer
ttttaataagtaaatcatctatatctatat Protospacer
*********** *********.* *
228. spacer 2.19|896690|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ776583 (Clostridium botulinum strain KapchunkaB3 plasmid pKAPB3, complete sequence) position: , mismatch: 8, identity: 0.733
agttaataagtaactcatctataccacaaa CRISPR spacer
ttttaataagtaaatcatctatatctatat Protospacer
*********** *********.* *
229. spacer 2.19|896690|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ776579 (Clostridium botulinum strain KapchunkaB2 plasmid pKAPB2, complete sequence) position: , mismatch: 8, identity: 0.733
agttaataagtaactcatctataccacaaa CRISPR spacer
ttttaataagtaaatcatctatatctatat Protospacer
*********** *********.* *
230. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214954 (Mycoplasma neurolyticum strain NCTC10166 plasmid 4) position: , mismatch: 8, identity: 0.733
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
ccctaatgttaattatgtaggtattgaaaa Protospacer
... .** ********* ***********
231. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013988 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C17-MedDCM-OCT-S46-C132, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
-tttgcgtgataattatgttggtattgaaaa CRISPR spacer
gaccgca-aataattatgttgatattgaaag Protospacer
..**. .************.********.
232. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013987 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C17-MedDCM-OCT-S39-C214, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
-tttgcgtgataattatgttggtattgaaaa CRISPR spacer
gaccgca-aataattatgttgatattgaaag Protospacer
..**. .************.********.
233. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to AP013985 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C17-MedDCM-OCT-S24-C90, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
-tttgcgtgataattatgttggtattgaaaa CRISPR spacer
gaccgca-aataattatgttgatattgaaag Protospacer
..**. .************.********.
234. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_017500 (Lactococcus lactis plasmid pSK11P, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
235. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP016737 (Lactococcus lactis subsp. cremoris strain JM3 plasmid pJM3A, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
236. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP016707 (Lactococcus lactis subsp. cremoris strain UC109 plasmid pUC109A, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
237. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NC_008505 (Lactococcus lactis subsp. cremoris SK11 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
238. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP016702 (Lactococcus lactis subsp. lactis strain 275 plasmid p275D, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
239. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP016686 (Lactococcus lactis subsp. cremoris strain 158 plasmid p158B, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
aaagaggtatctaagtattctttatattga Protospacer
* . ************.*********
240. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
241. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatatata Protospacer
. * * *************** *****
242. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatatata Protospacer
. * * *************** *****
243. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
244. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
245. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014345 (Campylobacter jejuni strain RM3194 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
246. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
247. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
248. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
249. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
250. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
251. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP017417 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-2, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
252. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
253. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
254. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP048772 (Campylobacter jejuni strain ZS007 plasmid pCJ145K, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
255. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP048774 (Campylobacter jejuni strain ZS007 plasmid pCJ3.6K, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
256. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
257. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
taagttttatctaagtattttatatataca Protospacer
. * * *************** *****
258. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to MK448707 (Streptococcus phage Javan227, complete genome) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
ttattattatctaaatatttttcaatctca Protospacer
.*************.*******.* .*
259. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to LR135896 (uncultured phage genomic DNA containing rbcL region region) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
tcaacattatctaagtcttttttatcttta Protospacer
..* .*********** ******** **
260. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to MT774410 (CrAssphage cr272_1, complete genome) position: , mismatch: 8, identity: 0.733
ctattattatctaagtattttttatattgt CRISPR spacer
ctattattatcttagtaattttttctgaat Protospacer
************ **** ***** . .*
261. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to NC_019699 (Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence) position: , mismatch: 9, identity: 0.7
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
aacagataaatttcttaaattttctcagat Protospacer
. *** **************.**** . .
262. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to MN694363 (Marine virus AFVG_250M224, complete genome) position: , mismatch: 9, identity: 0.7
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
acttattaaatttcttaaatgttctatccc Protospacer
... .*************** ***** ..*
263. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to NC_031245 (Bacillus phage SP-15, complete genome) position: , mismatch: 9, identity: 0.7
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
tctaggtaaatttcttaactcttctaacgt Protospacer
..** ************ *******.. .
264. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttatatgttctttaatacctggaat Protospacer
********* **.**********..* .
265. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501134 (Phage DP-2017a isolate CA39E hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
266. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501136 (Phage DP-2017a isolate CA40B hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
267. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501135 (Phage DP-2017a isolate CA40A hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
268. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501137 (Phage DP-2017a isolate CA40C hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
269. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501138 (Phage DP-2017a isolate CA40D hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
270. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KX501139 (Phage DP-2017a isolate CA40E hypothetical protein, tape measure, hypothetical protein, LysM, D-like protein, hypothetical protein, type IV secretion protein, baseplate, hypothetical protein, hydrolase, hypothetical protein, helicase, primase, type III restriction endonuclease, and exonuclease genes, complete cds) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gttctttttattattctttaatattgaacga Protospacer
******* * ************** .
271. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043858 (Arcobacter cibarius strain H743 plasmid pACIB, complete sequence) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
catattttaaatattctctaaaatttctcaa Protospacer
. * *************.*** *****. .
272. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035808 (Spirochaeta perfilievii strain P plasmid pSpe, complete sequence) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcttttaaatattctaaaataaagacagt Protospacer
***************** **** *.
273. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053909 (Hymenobacter sp. BRD128 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ccccttttaagtattttttaatatttgtcta Protospacer
...*******.****.********** . *.
274. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017256 (Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
aatatttttaatattttttaatatttctcca Protospacer
* **** ******.***********. ..
275. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016898 (Acinetobacter soli strain GFJ2 plasmid pGFJ2, complete sequence) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
aatcgtttaaatattcttcaatattcatttc Protospacer
** *************.******. . *
276. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MH333064 (Klebsiella phage Mineola, complete genome) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
aaacatttaaatattctttaagttttcctct Protospacer
* **************** ***** .
277. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MG945516 (UNVERIFIED: Microviridae sp. isolate 1941-1706, complete genome) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
ctttttttaaatattctttcatatagttatt Protospacer
.**.*************** **** ...*
278. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK387337 (Vibrio phage ValB1MD, complete genome) position: , mismatch: 9, identity: 0.71
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tatcttctaaatattctttaaaattcatagt Protospacer
* ****.************** ***. ..
279. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
280. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
281. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
282. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
283. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
284. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
285. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035021 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pA) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
286. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035114 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed1) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
287. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046263 (Lactobacillus plantarum strain KCCP11226 plasmid pKCCP11226_01, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
288. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
289. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
290. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012657 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
291. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
292. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
293. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
294. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
295. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040376 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
296. spacer 2.6|895833|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
taaaataatggaaaatttaggaatcaaaca CRISPR spacer
acgtatattggaaaatttagcaatcaatat Protospacer
. *** ************ ******
297. spacer 2.15|896426|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_003273 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120delta, complete sequence) position: , mismatch: 9, identity: 0.7
aactctatttagtagtaattataacagaat CRISPR spacer
aactttatttagaagtaattatattgactc Protospacer
****.******* ********** ... .
298. spacer 2.16|896492|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035408 (Bacillus subtilis strain SRCM103612 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
gttatttttcaataaactaatctattgtat CRISPR spacer
aaaatttttcaatcaactaatcaattcgga Protospacer
. ********** ******** *** .
299. spacer 2.16|896492|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to LC081338 (Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome) position: , mismatch: 9, identity: 0.7
gttatttttcaataaactaatctattgtat CRISPR spacer
ccattttttcaataaacatatctattgcta Protospacer
. ************* ********.
300. spacer 2.17|896558|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NC_003273 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120delta, complete sequence) position: , mismatch: 9, identity: 0.7
aactctatttagtagtaattataacagaat CRISPR spacer
aactttatttagaagtaattatattgactc Protospacer
****.******* ********** ... .
301. spacer 2.18|896624|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035408 (Bacillus subtilis strain SRCM103612 plasmid unnamed2) position: , mismatch: 9, identity: 0.7
gttatttttcaataaactaatctattgtat CRISPR spacer
aaaatttttcaatcaactaatcaattcgga Protospacer
. ********** ******** *** .
302. spacer 2.18|896624|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to LC081338 (Vibrio sp. 04Ya108 plasmid pSEA1 DNA, complete genome) position: , mismatch: 9, identity: 0.7
gttatttttcaataaactaatctattgtat CRISPR spacer
ccattttttcaataaacatatctattgcta Protospacer
. ************* ********.
303. spacer 2.19|896690|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to KT997857 (Uncultured Mediterranean phage uvDeep-CGR2-KM18-C269, complete genome) position: , mismatch: 9, identity: 0.7
agttaataagtaactcatctataccacaaa CRISPR spacer
caactataagtaactcatctgtaccatcat Protospacer
. . ***************.*****. *
304. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.7
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
gccaatggataatgaagttggtattgaaaa Protospacer
... ****** * **************
305. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 9, identity: 0.7
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
gccaatggataatgaagttggtattgaaaa Protospacer
... ****** * **************
306. spacer 2.23|896953|30|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.7
tttgcgtgataattatgttggtattgaaaa CRISPR spacer
accaatggataatgaagttggtattgaaaa Protospacer
... ****** * **************
307. spacer 2.29|897348|30|LS991952|CRISPRCasFinder,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
ctattattatctaagtattttttatattgt CRISPR spacer
tgattattatcaaagtattttatatgggac Protospacer
. ********* ********* ***. ..
308. spacer 2.3|895634|30|LS991952|CRISPRCasFinder,CRT matches to MN694049 (Marine virus AFVG_250M506, complete genome) position: , mismatch: 10, identity: 0.667
gtcagttaaatttcttaaatcttctagttc CRISPR spacer
aatttttaaattttttaaatcttctaaaga Protospacer
. . ********.************.
309. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN180248 (UNVERIFIED: Wolbachia phage WO isolate Seq1WORi_AMD1 genomic sequence) position: , mismatch: 10, identity: 0.677
tttcttttaaatattctttaatatttccgtg CRISPR spacer
tttcatttaaataatctttaatagagttaac Protospacer
**** ******** ********* ...
310. spacer 2.5|895766|31|LS991952|CRISPRCasFinder,CRT,PILER-CR matches to MN856004 (Myoviridae sp. isolate 289, complete genome) position: , mismatch: 10, identity: 0.677
tttcttttaaatattctttaatatttccgtg CRISPR spacer
gccaggttaaataatctttaatatgtccgac Protospacer
.. ******* ********** ****
