1. spacer 3.90|981400|30|LS483523|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.9
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agcgcaagtacgtcattaagcacgtcagta Protospacer
*************** .***********.*
2. spacer 3.106|982216|30|LS483523|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.9
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agcgcaagtacgtcattaagcacgtcagta Protospacer
*************** .***********.*
3. spacer 3.302|975514|30|LS483523|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.9
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agcgcaagtacgtcattaagcacgtcagta Protospacer
*************** .***********.*
4. spacer 3.331|976984|30|LS483523|CRT matches to NZ_CP046029 (Staphylococcus chromogenes strain 1401 plasmid unnamed1) position: , mismatch: 3, identity: 0.9
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agcgcaagtacgtcattaagcacgtcagta Protospacer
*************** .***********.*
5. spacer 3.381|983635|30|LS483523|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.867
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gcaagaaggtccgcatcaacaagcgcgtgt Protospacer
***** * ******************. **
6. spacer 3.111|982420|30|LS483523|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 5, identity: 0.833
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
agggcaagaaggtccgcatcaacaagcgcg Protospacer
****** * ******************.
7. spacer 3.112|982468|30|LS483523|CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 5, identity: 0.833
tcggcat-caacaagcgcgtcgacctcagca CRISPR spacer
-cgacctgcaacaagcgggtcgaactcagca Protospacer
**.* * ********* ***** *******
8. spacer 3.256|985816|30|LS483523|CRT matches to MK494091 (Mycobacterium phage Scorpia, complete genome) position: , mismatch: 5, identity: 0.833
tcgacc-tcagcaagcacgtcagcaagtaca CRISPR spacer
-cgcccgtcagccaacacgtcagcaagtacg Protospacer
** ** ***** *.***************.
9. spacer 3.256|985816|30|LS483523|CRT matches to JN083853 (Mycobacterium phage Airmid, complete genome) position: , mismatch: 5, identity: 0.833
tcgacc-tcagcaagcacgtcagcaagtaca CRISPR spacer
-cgtccgtcagccaacacgtcagcaagtacg Protospacer
** ** ***** *.***************.
10. spacer 3.258|985900|30|LS483523|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 5, identity: 0.833
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
acgccgtcggcaagcacgtcagcaagcacg Protospacer
* ****.********.************
11. spacer 3.258|985900|30|LS483523|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
acgccgtcggcaagcacgtcagcaagcacg Protospacer
* ****.********.************
12. spacer 3.258|985900|30|LS483523|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
acgccgtcggcaagcacgtcagcaagcacg Protospacer
* ****.********.************
13. spacer 3.336|977188|30|LS483523|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 5, identity: 0.833
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
agggcaagaaggtccgcatcaacaagcgcg Protospacer
****** * ******************.
14. spacer 3.337|977236|30|LS483523|CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 5, identity: 0.833
tcggcat-caacaagcgcgtcgacctcagca CRISPR spacer
-cgacctgcaacaagcgggtcgaactcagca Protospacer
**.* * ********* ***** *******
15. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 5, identity: 0.833
gcatcaacaagcgcgtcgacctca-gcaagc CRISPR spacer
acatcaacaagggcttcgacctcatgcatg- Protospacer
.********** ** ********* *** *
16. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 5, identity: 0.833
gcatcaacaagcgcgtcgacctca-gcaagc CRISPR spacer
acatcaacaagggcttcgacctcatgcatg- Protospacer
.********** ** ********* *** *
17. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.833
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagttcatcggcaactacgtccacgaca Protospacer
****** ********* *******.*. **
18. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.833
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagttcatcggcaactacgtccacgaca Protospacer
****** ********* *******.*. **
19. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 5, identity: 0.833
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagttcatcggcaattacgtccacgaca Protospacer
****** ********* *******.*. **
20. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.833
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagttcatcggcaactacgtccacgaca Protospacer
****** ********* *******.*. **
21. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.833
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagttcatcggcaattacgtccacgaca Protospacer
****** ********* *******.*. **
22. spacer 3.111|982420|30|LS483523|CRT matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 6, identity: 0.8
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
tttgctggtacgtctgcatcaccaagcgca Protospacer
*. ** .*******.****** ********
23. spacer 3.111|982420|30|LS483523|CRT matches to MG592541 (Vibrio phage 1.174.O._10N.261.55.A8, partial genome) position: , mismatch: 6, identity: 0.8
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
tttgctggtacgtctgcatcatcaagcgca Protospacer
*. ** .*******.****** ********
24. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 6, identity: 0.8
tcggca-tcaacaagcgcgtcgacctcagca CRISPR spacer
-agacaggcaacaagggcgtcgacctcatca Protospacer
*.** ******* ************ **
25. spacer 3.336|977188|30|LS483523|CRT matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 6, identity: 0.8
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
tttgctggtacgtctgcatcaccaagcgca Protospacer
*. ** .*******.****** ********
26. spacer 3.336|977188|30|LS483523|CRT matches to MG592541 (Vibrio phage 1.174.O._10N.261.55.A8, partial genome) position: , mismatch: 6, identity: 0.8
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
tttgctggtacgtctgcatcatcaagcgca Protospacer
*. ** .*******.****** ********
27. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 6, identity: 0.8
tcggca-tcaacaagcgcgtcgacctcagca CRISPR spacer
-agacaggcaacaagggcgtcgacctcatca Protospacer
*.** ******* ************ **
28. spacer 3.381|983635|30|LS483523|CRT matches to CP000621 (Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence) position: , mismatch: 6, identity: 0.8
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gtaagaaagtccgcatcaacaagcggattt Protospacer
*.*** * ***************** * *
29. spacer 3.381|983635|30|LS483523|CRT matches to MT701594 (Streptomyces phage Spernnie, complete genome) position: , mismatch: 6, identity: 0.8
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gcaagcacgtccgcaacaacaagtacgagg Protospacer
*****.********* *******..*.**
30. spacer 3.383|983719|30|LS483523|CRT matches to NC_007766 (Rhizobium etli CFN 42 plasmid p42f, complete sequence) position: , mismatch: 6, identity: 0.8
gcatcaacaagcgcgtcgacctcagcaagc CRISPR spacer
cctgcaacaagcgggtcgaactcagcaaga Protospacer
* ********* ***** *********
31. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
gcatcaacaagcgcgtcgacctca-gcaagc CRISPR spacer
acatcaacaagggcttcgacctcatgcaca- Protospacer
.********** ** ********* *** .
32. spacer 3.42|978478|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
33. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.767
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
aggaaggccgcgtcggcttcagcatcgaca Protospacer
** * . .**************.******
34. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.767
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
aggaaggccgcgtcggcttcagcatcgaca Protospacer
** * . .**************.******
35. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.767
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
aggaaggccgcgtcggcttcagcatcgaca Protospacer
** * . .**************.******
36. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.767
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
aggaaggccgcgtcggcttcagcatcgaca Protospacer
** * . .**************.******
37. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.767
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
aggaaggccgcgtcggcttcagcatcgaca Protospacer
** * . .**************.******
38. spacer 3.58|979168|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
39. spacer 3.89|981352|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
40. spacer 3.90|981400|30|LS483523|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agttggcgaacgtcagcaagcaggtcagca Protospacer
**. . * ************* *******
41. spacer 3.92|981484|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
42. spacer 3.106|982216|30|LS483523|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agttggcgaacgtcagcaagcaggtcagca Protospacer
**. . * ************* *******
43. spacer 3.111|982420|30|LS483523|CRT matches to AP014939 (Citrobacter freundii plasmid pKHM-1 DNA, complete sequence, strain: KHM 243) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
44. spacer 3.111|982420|30|LS483523|CRT matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
45. spacer 3.111|982420|30|LS483523|CRT matches to NZ_AP018687 (Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
46. spacer 3.111|982420|30|LS483523|CRT matches to MT701594 (Streptomyces phage Spernnie, complete genome) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
cccgcaagcacgtccgcaacaacaagtacg Protospacer
.* *****.********* *******..*.
47. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP027671 (Simplicispira suum strain SC1-8 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcaacaagcacctcgacaccgacg Protospacer
***************.* ***** .*..*.
48. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcaaaacgcgcgtcgacgccatgg Protospacer
********** * ********** .** .
49. spacer 3.116|982624|30|LS483523|CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
acaacaagtacatcggcatcaacgcggtag Protospacer
**.*******************. * *
50. spacer 3.116|982624|30|LS483523|CRT matches to AP013475 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C83-MedDCM-OCT-S45-C54) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tactcaagttcatctgcatcaacaagcgat Protospacer
* ***** **** *************
51. spacer 3.116|982624|30|LS483523|CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcagccagtgcatcggcatcaacgtccgga Protospacer
***** ***.*************. ** .
52. spacer 3.116|982624|30|LS483523|CRT matches to MN096365 (Gordonia phage Samba, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
ccggcaactacatcggcatctacaagacca Protospacer
.*.**** ************ ***** *.
53. spacer 3.116|982624|30|LS483523|CRT matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
cgggcaactacatcggcatctacaagaccg Protospacer
. .**** ************ ***** **
54. spacer 3.116|982624|30|LS483523|CRT matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
cgggcaactacatcggcatctacaagaccg Protospacer
. .**** ************ ***** **
55. spacer 3.258|985900|30|LS483523|CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 7, identity: 0.767
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
gcaaagccagcaagtacagcagcaagcacg Protospacer
. * *.*******.*** ***********
56. spacer 3.258|985900|30|LS483523|CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 7, identity: 0.767
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
gcaaagccagcaagtacagcagcaagcacg Protospacer
. * *.*******.*** ***********
57. spacer 3.258|985900|30|LS483523|CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 7, identity: 0.767
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
gcaaagccagcaagtacagcagcaagcacg Protospacer
. * *.*******.*** ***********
58. spacer 3.264|986128|30|LS483523|CRT matches to MK759884 (Salmonella phage vB_SenM_SB18, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
59. spacer 3.264|986128|30|LS483523|CRT matches to NC_015292 (Erwinia phage phiEa104, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
60. spacer 3.264|986128|30|LS483523|CRT matches to MH426725 (Erwinia phage SunLIRen, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
61. spacer 3.264|986128|30|LS483523|CRT matches to FQ482083 (Erwinia amylovora phage phiEa104 complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
62. spacer 3.264|986128|30|LS483523|CRT matches to NC_011811 (Erwinia phage phiEa21-4, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
63. spacer 3.264|986128|30|LS483523|CRT matches to MG589384 (Enterobacter phage phi63_307, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
64. spacer 3.264|986128|30|LS483523|CRT matches to MK770412 (Salmonella phage SE5, complete genome) position: , mismatch: 7, identity: 0.767
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
acctcatcagcttcgactgttacaagtctg Protospacer
* * **********.** ********* .
65. spacer 3.284|974722|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
66. spacer 3.290|975046|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
67. spacer 3.302|975514|30|LS483523|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agttggcgaacgtcagcaagcaggtcagca Protospacer
**. . * ************* *******
68. spacer 3.303|975562|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
69. spacer 3.305|975682|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
70. spacer 3.315|976270|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
71. spacer 3.317|976360|30|LS483523|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcgtcgacctcagcaagcacgtcagca-- CRISPR spacer
cccgcgtcgacctcagcatgcac--caactga Protospacer
**************** **** **.*
72. spacer 3.331|976984|30|LS483523|CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.767
agcgcaagtacgtcagcaagcacgtcagca CRISPR spacer
agttggcgaacgtcagcaagcaggtcagca Protospacer
**. . * ************* *******
73. spacer 3.336|977188|30|LS483523|CRT matches to AP014939 (Citrobacter freundii plasmid pKHM-1 DNA, complete sequence, strain: KHM 243) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
74. spacer 3.336|977188|30|LS483523|CRT matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
75. spacer 3.336|977188|30|LS483523|CRT matches to NZ_AP018687 (Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca- CRISPR spacer
ggagcaagtacgtcctcatcaacaa-tgtac Protospacer
.************ ********* .*.*
76. spacer 3.336|977188|30|LS483523|CRT matches to MT701594 (Streptomyces phage Spernnie, complete genome) position: , mismatch: 7, identity: 0.767
tcggcaagtacgtccgcatcaacaagcgca CRISPR spacer
cccgcaagcacgtccgcaacaacaagtacg Protospacer
.* *****.********* *******..*.
77. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP027671 (Simplicispira suum strain SC1-8 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcaacaagcacctcgacaccgacg Protospacer
***************.* ***** .*..*.
78. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 7, identity: 0.767
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcaaaacgcgcgtcgacgccatgg Protospacer
********** * ********** .** .
79. spacer 3.341|977392|30|LS483523|CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
acaacaagtacatcggcatcaacgcggtag Protospacer
**.*******************. * *
80. spacer 3.341|977392|30|LS483523|CRT matches to AP013475 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C83-MedDCM-OCT-S45-C54) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tactcaagttcatctgcatcaacaagcgat Protospacer
* ***** **** *************
81. spacer 3.341|977392|30|LS483523|CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcagccagtgcatcggcatcaacgtccgga Protospacer
***** ***.*************. ** .
82. spacer 3.341|977392|30|LS483523|CRT matches to MN096365 (Gordonia phage Samba, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
ccggcaactacatcggcatctacaagacca Protospacer
.*.**** ************ ***** *.
83. spacer 3.341|977392|30|LS483523|CRT matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
cgggcaactacatcggcatctacaagaccg Protospacer
. .**** ************ ***** **
84. spacer 3.341|977392|30|LS483523|CRT matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 7, identity: 0.767
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
cgggcaactacatcggcatctacaagaccg Protospacer
. .**** ************ ***** **
85. spacer 3.381|983635|30|LS483523|CRT matches to AP014939 (Citrobacter freundii plasmid pKHM-1 DNA, complete sequence, strain: KHM 243) position: , mismatch: 7, identity: 0.767
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gcaagtacgtcctcatcaacaatgtaccgt Protospacer
************ ********* **
86. spacer 3.381|983635|30|LS483523|CRT matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gcaagtacgtcctcatcaacaatgtaccgt Protospacer
************ ********* **
87. spacer 3.381|983635|30|LS483523|CRT matches to NZ_AP018687 (Vibrio rumoiensis strain FERM P-14531 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gcaagtacgtcctcatcaacaatgtaccgt Protospacer
************ ********* **
88. spacer 3.381|983635|30|LS483523|CRT matches to MG592531 (Vibrio phage 1.164.O._10N.261.51.A7, partial genome) position: , mismatch: 7, identity: 0.767
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gctggtacgtctgcatcaccaagcgcagca Protospacer
** .*******.****** ********.
89. spacer 3.381|983635|30|LS483523|CRT matches to MG592541 (Vibrio phage 1.174.O._10N.261.55.A8, partial genome) position: , mismatch: 7, identity: 0.767
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
gctggtacgtctgcatcatcaagcgcagca Protospacer
** .*******.****** ********.
90. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP016722 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11C, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcaacaagcgcgtcgacctcagcaagc CRISPR spacer
agtcaaacaagggcgtcgacctcagcaagt Protospacer
. . ****** *****************.
91. spacer 3.383|983719|30|LS483523|CRT matches to NC_004444 (Pseudomonas resinovorans plasmid pCAR1, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcaa---caagcgcgtcgacctcagcaagc CRISPR spacer
---tccagctcaagcgcgtcgacctcatcaact Protospacer
** * ***************** *** .
92. spacer 3.383|983719|30|LS483523|CRT matches to NC_021506 (Pseudomonas resinovorans NBRC 106553 plasmid pCAR1.3, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcaa---caagcgcgtcgacctcagcaagc CRISPR spacer
---tccagctcaagcgcgtcgacctcatcaact Protospacer
** * ***************** *** .
93. spacer 3.383|983719|30|LS483523|CRT matches to NC_011838 (Pseudomonas putida plasmid pCAR1.2, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcaa---caagcgcgtcgacctcagcaagc CRISPR spacer
---tccagctcaagcgcgtcgacctcatcaact Protospacer
** * ***************** *** .
94. spacer 3.390|983983|30|LS483523|CRT matches to MN224564 (Streptomyces phage Araceli, complete genome) position: , mismatch: 7, identity: 0.767
gcatcaacaagcgcaagtacgtcagcaagc CRISPR spacer
acgccgacaagcgcgagtacgtccgcaagg Protospacer
.*..*.********.******** *****
95. spacer 3.390|983983|30|LS483523|CRT matches to MH697589 (Microbacterium phage Neferthena, complete genome) position: , mismatch: 7, identity: 0.767
gcatcaacaagcgcaagtacgtcagcaagc--- CRISPR spacer
tcatcaacaagggcaaggacgt---cacgctca Protospacer
********** ***** **** ** **
96. spacer 3.390|983983|30|LS483523|CRT matches to MH229863 (Streptomyces phage JackieB, complete genome) position: , mismatch: 7, identity: 0.767
gcatcaacaagcgcaagtacgtcagcaagc CRISPR spacer
acgccgacaagcgcgagtacgtccgcaagg Protospacer
.*..*.********.******** *****
97. spacer 3.390|983983|30|LS483523|CRT matches to MH229862 (Streptomyces phage Henoccus, complete genome) position: , mismatch: 7, identity: 0.767
gcatcaacaagcgcaagtacgtcagcaagc CRISPR spacer
acgccgacaagcgcgagtacgtccgcaagg Protospacer
.*..*.********.******** *****
98. spacer 3.394|984139|30|LS483523|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgacaagtgcaagcacatcggcgtca CRISPR spacer
ccctcgacaagcgcaagcacaccggcaccg Protospacer
* ********.*********.****..*.
99. spacer 3.394|984139|30|LS483523|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 7, identity: 0.767
gcatcgacaagtgcaagcacatcggcgtca CRISPR spacer
ccctcgacaagcgcaagcacaccggcaccg Protospacer
* ********.*********.****..*.
100. spacer 3.395|984187|30|LS483523|CRT matches to MF580956 (Salinibacter virus M8CC-19, complete genome) position: , mismatch: 7, identity: 0.767
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
cgaagtacatcggcaagtccgaccgcaaac Protospacer
**************** ** *****
101. spacer 3.395|984187|30|LS483523|CRT matches to MF580959 (Salinibacter virus M8CRM-1, partial genome) position: , mismatch: 7, identity: 0.767
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
cgaagtacatcggcaagtccgaccgcaaac Protospacer
**************** ** *****
102. spacer 3.395|984187|30|LS483523|CRT matches to MF580960 (Salinibacter virus M31CC-1, partial genome) position: , mismatch: 7, identity: 0.767
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
cgaagtacatcggcaagtccgaccgcaaac Protospacer
**************** ** *****
103. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagtacatcggcaagaacttcaacaatg Protospacer
***************** ** ** .** ..
104. spacer 3.395|984187|30|LS483523|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gcaagtacatcggcaagtacgtccgcatca CRISPR spacer
gcaagtacatcggcaagaacttcgacaatg Protospacer
***************** ** ** .** ..
105. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP016722 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11C, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
gcaagtcaaacaagggcgtcgacctcagca Protospacer
*.. . ****** ***************
106. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
cccacatcaagaagctcgtcgacctcaagg Protospacer
.* .****** **** ***********. .
107. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aagacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
108. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aggacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
109. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aggacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
110. spacer 3.116|982624|30|LS483523|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcaggaagtacatcggcaccaacatcattt Protospacer
**** *************.***** .
111. spacer 3.116|982624|30|LS483523|CRT matches to MN693854 (Marine virus AFVG_250M929, complete genome) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tctgcaagtacatctgcatcaactgcaacc Protospacer
** *********** ******** . .*
112. spacer 3.116|982624|30|LS483523|CRT matches to MN694256 (Marine virus AFVG_250M930, complete genome) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tctgcaagtacatctgcatcaactgcaacc Protospacer
** *********** ******** . .*
113. spacer 3.116|982624|30|LS483523|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
ccagcgagtacatcggcagcaacatcctga Protospacer
.****.************ ***** * .
114. spacer 3.116|982624|30|LS483523|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcagcaagtacatcgggatcattccgttca Protospacer
**************** **** . *. *.
115. spacer 3.256|985816|30|LS483523|CRT matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 8, identity: 0.733
tcgacctcagcaagcacgtcagcaagtaca CRISPR spacer
ccaacctcagcaagcacctcaacaagctgg Protospacer
.*.************** ***.****. .
116. spacer 3.256|985816|30|LS483523|CRT matches to MN586060 (Mycobacterium phage PetterN, complete genome) position: , mismatch: 8, identity: 0.733
tcgacctcagcaagcacgtcagcaagtaca CRISPR spacer
cacccgtcagccaccacgtcagcaagtacg Protospacer
. * ***** * ***************.
117. spacer 3.256|985816|30|LS483523|CRT matches to KT246486 (Mycobacterium phage Chadwick, complete genome) position: , mismatch: 8, identity: 0.733
tcgacctcagcaagcacgtcagcaagtaca CRISPR spacer
cacccgtcagccaccacgtcagcaagtacg Protospacer
. * ***** * ***************.
118. spacer 3.258|985900|30|LS483523|CRT matches to MT227925 (Vibrio phage phiV141, complete genome) position: , mismatch: 8, identity: 0.733
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
gatgttaaagcaagcacatcagaaagcacg Protospacer
..*.. ************** *******
119. spacer 3.258|985900|30|LS483523|CRT matches to MN582094 (Siphoviridae sp. ctjeG17, complete genome) position: , mismatch: 8, identity: 0.733
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
tttgcgacagcaagaacatcagcaagcgac Protospacer
*.** ******* ************.
120. spacer 3.258|985900|30|LS483523|CRT matches to HQ633071 (Synechococcus phage S-SKS1 genomic sequence) position: , mismatch: 8, identity: 0.733
agtacgtcagcaagcacatcagcaagcacg CRISPR spacer
tgattatcagcaagcaaatcagaaagcact Protospacer
* ..********** ***** ******
121. spacer 3.264|986128|30|LS483523|CRT matches to MH179480 (Pseudomonas phage 98PfluR60PP, complete genome) position: , mismatch: 8, identity: 0.733
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
agcacatcagcttcagcagctacgtcacca Protospacer
***************.***.***. *
122. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP016722 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11C, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
gcaagtcaaacaagggcgtcgacctcagca Protospacer
*.. . ****** ***************
123. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
cccacatcaagaagctcgtcgacctcaagg Protospacer
.* .****** **** ***********. .
124. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aagacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
125. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aggacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
126. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 8, identity: 0.733
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
aggacatcaacaagggcttcgacctcatgc Protospacer
*.********** ** *********
127. spacer 3.341|977392|30|LS483523|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcaggaagtacatcggcaccaacatcattt Protospacer
**** *************.***** .
128. spacer 3.341|977392|30|LS483523|CRT matches to MN693854 (Marine virus AFVG_250M929, complete genome) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tctgcaagtacatctgcatcaactgcaacc Protospacer
** *********** ******** . .*
129. spacer 3.341|977392|30|LS483523|CRT matches to MN694256 (Marine virus AFVG_250M930, complete genome) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tctgcaagtacatctgcatcaactgcaacc Protospacer
** *********** ******** . .*
130. spacer 3.341|977392|30|LS483523|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
ccagcgagtacatcggcagcaacatcctga Protospacer
.****.************ ***** * .
131. spacer 3.341|977392|30|LS483523|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
tcagcaagtacatcggcatcaacaagcgcg CRISPR spacer
tcagcaagtacatcgggatcattccgttca Protospacer
**************** **** . *. *.
132. spacer 3.381|983635|30|LS483523|CRT matches to MH220877 (Oenococcus phage phiOE33PA, complete genome) position: , mismatch: 8, identity: 0.733
gcaagtacgtccgcatcaacaagcgcaagt CRISPR spacer
atttttccgtccggaccaacaagcgcaagt Protospacer
.. * ****** *.**************
133. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
gcatcaacaagcgcgtcgacctcagcaagc CRISPR spacer
acatcaagaagctcgtcgacctcaaggcac Protospacer
.****** **** ***********. . .*
134. spacer 3.390|983983|30|LS483523|CRT matches to CP003186 (Thermoanaerobacterium phage THSA-485A, complete genome) position: , mismatch: 8, identity: 0.733
gcatcaacaagcgcaagtacgtcagcaagc CRISPR spacer
atgccaacaagtgcaagtacgccagcagcc Protospacer
....*******.*********.*****. *
135. spacer 3.55|979030|30|LS483523|CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 9, identity: 0.7
agtaccagtgcgtcggcttcagcgtcgaca CRISPR spacer
ggggaagctgcgtcggcttcatcgtcgacc Protospacer
.* . . ************* *******
136. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 9, identity: 0.7
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcagcaagcgcggcgacacttatt Protospacer
*********.******** **** .. ..
137. spacer 3.112|982468|30|LS483523|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 9, identity: 0.7
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcagcaagcgcggcgacacttatt Protospacer
*********.******** **** .. ..
138. spacer 3.264|986128|30|LS483523|CRT matches to NC_049494 (Acinetobacter phage vB_AbaM_PhT2, complete genome) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
ccttttgcagcttcaacagttacaattgca Protospacer
. . ****************** ***
139. spacer 3.264|986128|30|LS483523|CRT matches to AP013499 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S39-C84) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
140. spacer 3.264|986128|30|LS483523|CRT matches to AP013497 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S35-C79) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
141. spacer 3.264|986128|30|LS483523|CRT matches to AP013498 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S38-C76) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
142. spacer 3.264|986128|30|LS483523|CRT matches to AP013776 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S36-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
143. spacer 3.264|986128|30|LS483523|CRT matches to AP013496 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C68A-MedDCM-OCT-S28-C61) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
144. spacer 3.264|986128|30|LS483523|CRT matches to AP013775 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C68A-MedDCM-OCT-S26-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.7
agcacatcagcttcaacagttacaagtgcc CRISPR spacer
tcaacatcagcttctacagttacaccccac Protospacer
*********** ********* . *
145. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 9, identity: 0.7
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcagcaagcgcggcgacacttatt Protospacer
*********.******** **** .. ..
146. spacer 3.337|977236|30|LS483523|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 9, identity: 0.7
tcggcatcaacaagcgcgtcgacctcagca CRISPR spacer
tcggcatcagcaagcgcggcgacacttatt Protospacer
*********.******** **** .. ..
147. spacer 3.383|983719|30|LS483523|CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 9, identity: 0.7
gcatcaacaagcgcgtcgacctcagcaagc CRISPR spacer
caggcaacaagggcgtcgacctcatcatcg Protospacer
. ******* ************ **
148. spacer 3.90|981400|30|LS483523|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
149. spacer 3.90|981400|30|LS483523|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
150. spacer 3.90|981400|30|LS483523|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
151. spacer 3.106|982216|30|LS483523|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
152. spacer 3.106|982216|30|LS483523|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
153. spacer 3.106|982216|30|LS483523|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
154. spacer 3.302|975514|30|LS483523|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
155. spacer 3.302|975514|30|LS483523|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
156. spacer 3.302|975514|30|LS483523|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
157. spacer 3.331|976984|30|LS483523|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
158. spacer 3.331|976984|30|LS483523|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
159. spacer 3.331|976984|30|LS483523|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.567
agcgcaagtacgtcagcaagcacgtcagca------------ CRISPR spacer
------------tcggcaagcacgtcagcaagcacgcgacgc Protospacer
**.***************
