1. spacer 3.12|916493|33|LS483464|CRT,PILER-CR matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 6, identity: 0.818
ctcagtgatctcccacgctacgtttggccacgg CRISPR spacer
ctcagtgatctcctgcgctacgttttccatcgg Protospacer
*************..********** * ***
2. spacer 3.30|916493|32|LS483464|CRISPRCasFinder matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 6, identity: 0.812
ctcagtgatctcccacgctacgtttggccacg CRISPR spacer
ctcagtgatctcctgcgctacgttttccatcg Protospacer
*************..********** * **
3. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 6, identity: 0.812
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
ggctggtgtcggtgagggtgccttttttcgcg Protospacer
* ************.****** ****** .*
4. spacer 3.8|916249|33|LS483464|CRT,PILER-CR matches to KU647629 (Arthrobacter phage BarretLemon, complete genome) position: , mismatch: 7, identity: 0.788
ttcgagatcgtgcccggcaaacgcggcgccaac CRISPR spacer
tgcttgatcgtgcgcggcagacgcggcgcgagc Protospacer
* * ******** *****.********* *.*
5. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 7, identity: 0.788
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
cgatggaggcggtgaaggtgccgtttttgagcg Protospacer
.***** * ******************* *
6. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 7, identity: 0.788
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
ggctggtgtcggtgagggtgccttttttcgcga Protospacer
* ************.****** ****** .*.
7. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to MH651172 (Streptomyces phage Comrade, complete genome) position: , mismatch: 7, identity: 0.788
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
ggctcgtgccggtgaaggtgccgttgttcaagg Protospacer
* * ***.**************** *** **
8. spacer 3.26|916249|32|LS483464|CRISPRCasFinder matches to KU647629 (Arthrobacter phage BarretLemon, complete genome) position: , mismatch: 7, identity: 0.781
ttcgagatcgtgcccggcaaacgcggcgccaa CRISPR spacer
tgcttgatcgtgcgcggcagacgcggcgcgag Protospacer
* * ******** *****.********* *.
9. spacer 3.26|916249|32|LS483464|CRISPRCasFinder matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ttcgagatcgtgcccggcaaacgcggcgccaa CRISPR spacer
tccgggtccgtgcccggcaacctcggcgccac Protospacer
*.**.* .************ * ********
10. spacer 3.27|916310|32|LS483464|CRISPRCasFinder matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
tggtgcc-tcgactggggtgccggtggggtgga CRISPR spacer
-gatgtcgccgacgggggtgccggtggcgtggg Protospacer
*.**.* .**** ************* ****.
11. spacer 3.33|916676|32|LS483464|CRISPRCasFinder matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781
ggaatgtga-ggttcatggtgtgtcctttcggg CRISPR spacer
-agatgcggcggctcatggtgtgtcctctcggg Protospacer
..***.*. **.**************.*****
12. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
cgatggaggcggtgaaggtgccgtttttgagc Protospacer
.***** * *******************
13. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP018028 (Alteromonas mediterranea strain CP49 plasmid MCP49-600, complete sequence) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
agatggtgtctgtgtaggtgccgttagtcgtt Protospacer
********* *** ********** ** *
14. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP018025 (Alteromonas mediterranea strain CP48 plasmid pAMCP48-600, complete sequence) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
agatggtgtctgtgtaggtgccgttagtcgtt Protospacer
********* *** ********** ** *
15. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MH651172 (Streptomyces phage Comrade, complete genome) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
ggctcgtgccggtgaaggtgccgttgttcaag Protospacer
* * ***.**************** *** *
16. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcctggggc Protospacer
************** * ****** ****
17. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgagggtgtcggtgacggtgccggtggtgttg Protospacer
*** *********** ******* * * .**
18. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MN855923 (Bacteriophage sp. isolate 465, complete genome) position: , mismatch: 7, identity: 0.781
tgatgg--tgtcggtgaaggtgccgtttttcctg CRISPR spacer
--atgggtcagcggtgaaggtgctgtttatcctg Protospacer
**** .. ************.**** *****
19. spacer 3.9|916310|33|LS483464|CRT,PILER-CR matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 8, identity: 0.758
tggtgcctcgactggggtgccggtggggtggag CRISPR spacer
ccgttcctcgaccggggtgccggtggtctcgcg Protospacer
. ** *******.************* * * *
20. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to NZ_CP018028 (Alteromonas mediterranea strain CP49 plasmid MCP49-600, complete sequence) position: , mismatch: 8, identity: 0.758
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
agatggtgtctgtgtaggtgccgttagtcgttt Protospacer
********* *** ********** ** *
21. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to NZ_CP018025 (Alteromonas mediterranea strain CP48 plasmid pAMCP48-600, complete sequence) position: , mismatch: 8, identity: 0.758
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
agatggtgtctgtgtaggtgccgttagtcgttt Protospacer
********* *** ********** ** *
22. spacer 3.26|916249|32|LS483464|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ttcgagatcgtgcccggcaaacgcggcgccaa CRISPR spacer
tccgccctcgtccccggcaaccgcggcgcccc Protospacer
*.** **** ******** *********
23. spacer 3.27|916310|32|LS483464|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 8, identity: 0.75
tggtgcctcgactggggtgccggtggggtgga CRISPR spacer
ccgttcctcgaccggggtgccggtggtctcgc Protospacer
. ** *******.************* * *
24. spacer 3.28|916371|32|LS483464|CRISPRCasFinder matches to NC_031004 (Gordonia phage Nyceirae, complete genome) position: , mismatch: 8, identity: 0.75
gatggttcggatgctgacgtacgcgccgggcg CRISPR spacer
ggcgtcgctgatgctgccgttcgcgccgggcg Protospacer
*..* . * ******* *** ***********
25. spacer 3.32|916615|32|LS483464|CRISPRCasFinder matches to NZ_CP037915 (Sphingomonas sp. AAP5 plasmid p150, complete sequence) position: , mismatch: 8, identity: 0.75
tttgcgacggagctggggccgattgcgaccgc CRISPR spacer
gtgatgccggagatggggccgatcgcgaccgg Protospacer
* ..* ***** **********.*******
26. spacer 3.33|916676|32|LS483464|CRISPRCasFinder matches to NZ_CP014516 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
ggaatgtgaggttcatggtgtgtcctttcggg CRISPR spacer
ggaaggtgaggttcagggtgtgttttcgcgtc Protospacer
**** ********** *******..*. **
27. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to LR743532 (Xanthomonas phage Bosa genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tggtggtgtcgttgaaggtgccgtgtggcagc Protospacer
**.******** ************ * *
28. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
29. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
30. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
31. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
32. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
33. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
34. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
35. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
36. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
37. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
38. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
39. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgcc-----gtttttcctg CRISPR spacer
tgatggtgttggagaaggtgccgaggagtctt----- Protospacer
*********.** ********* **.**
40. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
41. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggcgtcggtgacggtgccggaatagccg Protospacer
******.******** ******* * *.*
42. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
43. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
44. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
45. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
46. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
47. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
48. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
49. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
50. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
51. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
52. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
53. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
54. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
55. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
56. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
57. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
58. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
59. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
60. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
61. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
62. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
63. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
64. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
65. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
66. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
67. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
68. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
69. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
70. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
71. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
72. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
73. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
74. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
75. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
76. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
77. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
78. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
79. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
80. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
81. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
82. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
83. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
84. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
85. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
86. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
87. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
88. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
89. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg---- CRISPR spacer
tgatggtgtcggtgtacgtgccg----gcccggggc Protospacer
************** * ****** **.*
90. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to JQ680374 (Unidentified phage clone 2209_scaffold441 genomic sequence) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
agatggtgacggtgcaggtgccgtagtccttc Protospacer
******* ***** ********* *.*.*
91. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MN304816 (Phage 67_12, partial genome) position: , mismatch: 8, identity: 0.75
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggtctcggtgatggtgccgggctgctcg Protospacer
******* ******* ******* .* *..*
92. spacer 3.14|916615|33|LS483464|CRT,PILER-CR matches to NZ_CP037915 (Sphingomonas sp. AAP5 plasmid p150, complete sequence) position: , mismatch: 9, identity: 0.727
tttgcgacggagctggggccgattgcgaccgcg CRISPR spacer
gtgatgccggagatggggccgatcgcgaccggc Protospacer
* ..* ***** **********.*******
93. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to LR743532 (Xanthomonas phage Bosa genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.727
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
tggtggtgtcgttgaaggtgccgtgtggcagca Protospacer
**.******** ************ * * .
94. spacer 3.22|916004|32|LS483464|CRISPRCasFinder matches to NC_016566 (Shigella phage EP23, complete genome) position: , mismatch: 9, identity: 0.719
agtaaagtacgccgttgtcaacgccgtaaagg CRISPR spacer
attccagtacgccgtagtcaatgccgtatgca Protospacer
* * ********** *****.****** . .
95. spacer 3.26|916249|32|LS483464|CRISPRCasFinder matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgagatcgtgcccggcaaacgcggcgccaa CRISPR spacer
tggagcttcgtgcccgccaaacgcggcgacac Protospacer
* .. ********* *********** **
96. spacer 3.26|916249|32|LS483464|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgagatcgtgcccggcaaacgcggcgccaa CRISPR spacer
gtgcagatcctgcccggcaagcgcggcgagcg Protospacer
* ***** **********.******* .
97. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MG018224 (Stenotrophomonas phage DLP4, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tggtggtgtcgttgaaggtgccgtgcggcagc Protospacer
**.******** ************ . *
98. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggtgacggtgaagttgccggtgctgtca Protospacer
******** ******** ***** * .* ...
99. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to KY130461 (Mycobacterium phage Taptic, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
100. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MH001446 (Mycobacterium phage Megabear, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
101. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to AP018462 (Mycobacterium phage D12 DNA, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
102. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
103. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MK494114 (Mycobacterium phage Argie, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
104. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MK494132 (Mycobacterium phage Cepens, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
105. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to AP018463 (Mycobacterium phage PR DNA, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
106. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to MH001450 (Mycobacterium phage Jeon, complete genome) position: , mismatch: 9, identity: 0.719
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggagccggtgaaggtgccgcgcctcggc Protospacer
****** *.**************. ..**
107. spacer 3.35|916798|32|LS483464|CRISPRCasFinder matches to MK138526 (Pseudomonas phage vB_PaeM_LCK69, complete genome) position: , mismatch: 9, identity: 0.719
tcgggtgtttctttcctactcctcgatttaca CRISPR spacer
ccgggcgtttctttcctgctcctcagagagca Protospacer
.****.***********.******.. .**
108. spacer 3.8|916249|33|LS483464|CRT,PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 10, identity: 0.697
ttcgagatcgtgcccggcaaacgcggcgccaac CRISPR spacer
tggagcttcgtgcccgccaaacgcggcgacaca Protospacer
* .. ********* *********** **
109. spacer 3.8|916249|33|LS483464|CRT,PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.697
ttcgagatcgtgcccggcaaacgcggcgccaac CRISPR spacer
gtgcagatcctgcccggcaagcgcggcgagcgg Protospacer
* ***** **********.******* .
110. spacer 3.16|916737|33|LS483464|CRT,PILER-CR matches to MG018224 (Stenotrophomonas phage DLP4, complete genome) position: , mismatch: 10, identity: 0.697
tgatggtgtcggtgaaggtgccgtttttcctgg CRISPR spacer
tggtggtgtcgttgaaggtgccgtgcggcagca Protospacer
**.******** ************ . * .
111. spacer 3.33|916676|32|LS483464|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgtgaggttcatggtgtgtcctttcggg CRISPR spacer
ttgtggtgacgttcatggtgtgtccattgtcg Protospacer
. **** *************** ** *
112. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgacggtgccggtgaaggtgccgccgacgagg Protospacer
***.****.**************.. . *
113. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatggtgtcggtgtacgtgccggcccgcggc Protospacer
************** * ****** ... *
114. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
tgatgttgtcggcgaaggtgccggcgccgatc Protospacer
***** ******.********** . .. *
115. spacer 3.34|916737|32|LS483464|CRISPRCasFinder matches to KM101124 (Mycobacterium phage Squirty, complete genome) position: , mismatch: 10, identity: 0.688
tgatggtgtcggtgaaggtgccgtttttcctg CRISPR spacer
ggatggtggcggtgtaggtgccgtagtcgtat Protospacer
******* ***** ********* *. .
