Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483481 Salmonella enterica subsp. enterica serovar Bredeney strain NCTC6026 genome assembly, chromosome: 1 2 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,RT,DEDDh,DinG 0 29 7 0

Results visualization

1. LS483481
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483481_1 924665-925974 TypeI-E I-E
21 spacers
cas3,cas8e,cse2gr11,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483481_2 942733-943676 TypeI-E I-E
15 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483481_2 2.1|942761|33|LS483481|PILER-CR 942761-942793 33 NC_010392 Phage Gifsy-1, complete genome 47888-47920 0 1.0
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 65911-65943 0 1.0
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 87247-87279 0 1.0
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NC_010391 Salmonella phage Fels-1, complete genome 37115-37147 0 1.0
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 515-547 0 1.0
LS483481_2 2.12|943432|33|LS483481|PILER-CR 943432-943464 33 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 5506-5538 0 1.0
LS483481_2 2.16|942762|32|LS483481|CRISPRCasFinder,CRT 942762-942793 32 NC_010392 Phage Gifsy-1, complete genome 47888-47919 0 1.0
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 65912-65943 0 1.0
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 87247-87278 0 1.0
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NC_010391 Salmonella phage Fels-1, complete genome 37116-37147 0 1.0
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 515-546 0 1.0
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 95-126 0 1.0
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 2585-2616 0 1.0
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 105065-105096 0 1.0
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 5506-5537 0 1.0
LS483481_1 1.9|925182|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925182-925213 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 50515-50546 1 0.969
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NC_010392 Phage Gifsy-1, complete genome 21497-21529 1 0.97
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NC_010393 Phage Gifsy-2, complete genome 38914-38946 1 0.97
LS483481_2 2.6|943066|33|LS483481|PILER-CR 943066-943098 33 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 28846-28878 1 0.97
LS483481_2 2.9|943249|33|LS483481|PILER-CR 943249-943281 33 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 32069-32101 1 0.97
LS483481_2 2.12|943432|33|LS483481|PILER-CR 943432-943464 33 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 94-126 1 0.97
LS483481_2 2.12|943432|33|LS483481|PILER-CR 943432-943464 33 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 2584-2616 1 0.97
LS483481_2 2.12|943432|33|LS483481|PILER-CR 943432-943464 33 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 105065-105097 1 0.97
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NC_010392 Phage Gifsy-1, complete genome 21497-21528 1 0.969
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NC_010393 Phage Gifsy-2, complete genome 38915-38946 1 0.969
LS483481_2 2.21|943067|32|LS483481|CRISPRCasFinder,CRT 943067-943098 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 28847-28878 1 0.969
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 32069-32100 1 0.969
LS483481_2 2.2|942822|33|LS483481|PILER-CR 942822-942854 33 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 2256-2288 2 0.939
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NC_010392 Phage Gifsy-1, complete genome 7891-7923 2 0.939
LS483481_2 2.5|943005|33|LS483481|PILER-CR 943005-943037 33 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 9101-9133 2 0.939
LS483481_2 2.17|942823|32|LS483481|CRISPRCasFinder,CRT 942823-942854 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 2256-2287 2 0.938
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NC_010392 Phage Gifsy-1, complete genome 7891-7922 2 0.938
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 9101-9132 2 0.938
LS483481_2 2.3|942883|33|LS483481|PILER-CR 942883-942915 33 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 35847-35879 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_KP987215 Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence 70790-70822 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP029733 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence 37641-37673 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP035635 Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence 62133-62165 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 45128-45160 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 85530-85562 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 103609-103641 3 0.909
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP022492 Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 plasmid unnamed1, complete sequence 90997-91029 3 0.909
LS483481_2 2.12|943432|33|LS483481|PILER-CR 943432-943464 33 NZ_CP014707 Salmonella enterica subsp. enterica serovar Anatum strain USMARC-1735 plasmid pSAN1-1735, complete sequence 36455-36487 3 0.909
LS483481_2 2.18|942884|32|LS483481|CRISPRCasFinder,CRT 942884-942915 32 CP053320 Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence 35847-35878 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_KP987215 Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence 70790-70821 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP029733 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence 37642-37673 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP035635 Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence 62133-62164 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP030079 Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence 45128-45159 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 85530-85561 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP024681 Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence 103610-103641 3 0.906
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP022492 Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 plasmid unnamed1, complete sequence 90998-91029 3 0.906
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_CP014707 Salmonella enterica subsp. enterica serovar Anatum strain USMARC-1735 plasmid pSAN1-1735, complete sequence 36455-36486 3 0.906
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 9205-9237 4 0.879
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 280926-280958 4 0.879
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 9212-9244 4 0.879
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 9215-9247 4 0.879
LS483481_2 2.4|942944|33|LS483481|PILER-CR 942944-942976 33 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 9215-9247 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 19008-19040 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 19008-19040 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 84372-84404 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 63167-63199 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 85305-85337 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 86223-86255 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 35260-35292 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 35685-35717 4 0.879
LS483481_2 2.10|943310|33|LS483481|PILER-CR 943310-943342 33 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 112673-112705 4 0.879
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 9205-9236 4 0.875
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 280926-280957 4 0.875
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 9212-9243 4 0.875
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 9215-9246 4 0.875
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 9215-9246 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 35260-35291 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 19009-19040 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 19009-19040 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 84373-84404 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 35685-35716 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 63168-63199 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 112673-112704 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 85306-85337 4 0.875
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 86224-86255 4 0.875
LS483481_1 1.10|925243|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925243-925274 32 MH001450 Mycobacterium phage Jeon, complete genome 52496-52527 6 0.812
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 282027-282058 7 0.781
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP032691 Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence 277006-277037 7 0.781
LS483481_1 1.3|924816|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924816-924847 32 MN694526 Marine virus AFVG_250M936, complete genome 19637-19668 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 18540-18571 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP021139 Sulfuriferula sp. AH1 plasmid unnamed, complete sequence 34949-34980 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 713509-713540 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1958338-1958369 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1607565-1607596 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1733499-1733530 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1309026-1309057 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1322594-1322625 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1412851-1412882 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1446942-1446973 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1412851-1412882 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1446942-1446973 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1412851-1412882 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1412054-1412085 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1446942-1446973 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1446942-1446973 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1446942-1446973 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 738218-738249 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1412850-1412881 7 0.781
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1446945-1446976 7 0.781
LS483481_2 2.27|943433|32|LS483481|CRISPRCasFinder,CRT 943433-943464 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 11447-11478 7 0.781
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 16478-16509 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 16478-16509 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 242615-242646 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 224573-224604 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP054026 Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence 285767-285798 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 494228-494259 8 0.75
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP032928 Agrobacterium tumefaciens strain 1D1460 plasmid pAt1D1460, complete sequence 267700-267731 8 0.75
LS483481_1 1.8|925121|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925121-925152 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 701316-701347 8 0.75
LS483481_1 1.9|925182|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925182-925213 32 NZ_CP028385 Providencia heimbachae strain 99101 plasmid unnamed, complete sequence 46735-46766 8 0.75
LS483481_2 2.9|943249|33|LS483481|PILER-CR 943249-943281 33 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 18540-18572 8 0.758
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP050076 Enterobacter kobei strain 070 plasmid p070_B, complete sequence 2769-2800 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP041049 Citrobacter sp. CF971 plasmid pBM527-3, complete sequence 2001-2032 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP022300 Acinetobacter johnsonii strain IC001 plasmid pIC001B, complete sequence 1471-1502 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_KX912255 Enterobacter cloacae strain H140960786 plasmid pJF-786, complete sequence 23292-23323 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_KX863568 Citrobacter freundii strain AtetA plasmid pLNU-11, complete sequence 34497-34528 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_022346 Pseudomonas aeruginosa strain ST308 plasmid pCOL-1, complete sequence 6722-6753 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 LC486677 Serratia marcescens MRY16-414SMA plasmid pMRY16-414SMA_2 DNA, complete sequence 27530-27561 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_KU578314 Pseudomonas aeruginosa strain 10265 plasmid p10265-KPC, complete sequence 37605-37636 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_KR014106 Aeromonas hydrophila strain WCHAH01 plasmid pKPC2, complete sequence 39677-39708 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 MN539620 Citrobacter sp. strain 172116965 plasmid p116965-KPC, complete sequence 38679-38710 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 112-143 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 MN436715 Klebsiella pneumoniae strain NMI4661/17 plasmid pKRA-GES-5, complete sequence 14017-14048 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 LC155906 Achromobacter xylosoxidans plasmid pKUN4507_1 DNA, complete sequence, strain: KUN4507 2656-2687 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP027855 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-3, complete sequence 1966-1997 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP038596 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.1, complete sequence 12810-12841 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_AP019194 Aeromonas hydrophila strain GSH8-2 plasmid pGSH8-2, complete sequence 37837-37868 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 KM659090 Achromobacter sp. LM16 plasmid pLM16A1, complete sequence 2611-2642 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_AP019197 Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-2, complete sequence 52395-52426 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 DQ839391 Uncultured bacterium plasmid pRSB105, complete sequence 18510-18541 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 MK050973 Citrobacter freundii plasmid pCRE12-KPC, complete sequence 30111-30142 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP028566 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pKPC2_045096, complete sequence 37642-37673 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP019671 Burkholderia cenocepacia strain VC12308 plasmid unnamed, complete sequence 16427-16458 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP018968 Escherichia coli strain Ecol_542 plasmid pEC542_KPC, complete sequence 10052-10083 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_LS998784 Pseudomonas aeruginosa isolate 1 plasmid 2, complete sequence 22863-22894 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP026224 Aeromonas sp. ASNIH3 plasmid pKPC-cd17, complete sequence 34896-34927 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 MN477223 Enterobacter cloacae strain 30860 plasmid p30860-KPC, complete sequence 37679-37710 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP040685 Pseudomonas aeruginosa strain C79 plasmid p1, complete sequence 2881-2912 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_019267 Serratia marcescens plasmid pRIO-5, complete sequence 3873-3904 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_011604 Salmonella enterica subsp. enterica serovar Westhampton plasmid pWES-1, complete sequence 9118-9149 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_005909 Pseudomonas alcaligenes plasmid pRA2, complete sequence 19963-19994 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 10311-10342 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_LT992437 Citrobacter freundii isolate CF121SC21 plasmid 1, complete sequence 38852-38883 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MH909348 Klebsiella pneumoniae strain A1705 plasmid pA1705-KPC, complete sequence 40721-40752 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MH909350 Klebsiella pneumoniae strain A1706 plasmid pA1706-KPC, complete sequence 17232-17263 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MF497782 Morganella morganii strain Mmo-37590cz plasmid pMMO-37590cz, complete sequence 536-567 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MH624130 Aeromonas taiwanensis strain L186 plasmid p186-KPC, complete sequence 2824-2855 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MH919378 Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence 35841-35872 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP032895 Enterobacter kobei strain WCHEK045523 plasmid pKPC2_045523, complete sequence 41791-41822 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MF168945 Pseudomonas aeruginosa strain FFUP_PS_35 plasmid pJB35, complete sequence 21390-21421 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MG558000 Citrobacter freundii strain Cfr-33795cz plasmid pCfr-33795cz, complete sequence 536-567 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_047756 Caulobacter phage Sansa, complete genome 24638-24669 8 0.75
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 466363-466394 8 0.75
LS483481_1 1.1|924694|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924694-924725 32 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 364322-364353 9 0.719
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 40929-40960 9 0.719
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 157802-157833 9 0.719
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 179339-179370 9 0.719
LS483481_1 1.11|925304|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925304-925335 32 NC_015851 Acidithiobacillus caldus SM-1 megaplasmid, complete sequence 79853-79884 9 0.719
LS483481_1 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925426-925457 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 1340-1371 9 0.719
LS483481_1 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925426-925457 32 KX156762 Staphylococcus phage vB_SauS_IMEP5, complete genome 15936-15967 9 0.719
LS483481_1 1.21|925914|32|LS483481|CRISPRCasFinder,CRT 925914-925945 32 NC_047851 Brevibacterium phage LuckyBarnes, complete genome 31262-31293 9 0.719
LS483481_2 2.2|942822|33|LS483481|PILER-CR 942822-942854 33 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 59147-59179 9 0.727
LS483481_2 2.9|943249|33|LS483481|PILER-CR 943249-943281 33 NC_047756 Caulobacter phage Sansa, complete genome 24637-24669 9 0.727
LS483481_2 2.17|942823|32|LS483481|CRISPRCasFinder,CRT 942823-942854 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 59147-59178 9 0.719
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 126334-126365 9 0.719
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 47101-47132 9 0.719
LS483481_2 2.19|942945|32|LS483481|CRISPRCasFinder,CRT 942945-942976 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 126334-126365 9 0.719
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NZ_LR723669 Rhizobium sp. Khangiran2 plasmid 2 73596-73627 9 0.719
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 MK392366 Streptomyces phage Janus, complete genome 15497-15528 9 0.719
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP034654 Xanthomonas vasicola pv. arecae strain NCPPB 2649 plasmid pXCARECAE29, complete sequence 10636-10667 9 0.719
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP015374 Pandoraea pnomenusa strain MCB032 plasmid unnamed 3, complete sequence 16041-16072 9 0.719
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NC_016053 Xanthomonas arboricola pv. pruni str. CFBP 5530 plasmid pXap41, complete sequence 36980-37011 9 0.719
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_LR594694 Variovorax sp. WDL1 plasmid 6 124-155 9 0.719
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_MF344578 Pseudomonas aeruginosa strain 60512 plasmid p60512-IMP, complete sequence 23499-23530 9 0.719
LS483481_2 2.25|943311|32|LS483481|CRISPRCasFinder,CRT 943311-943342 32 HG796856 Uncultured bacterium plasmid pRGF00250 451-482 9 0.719
LS483481_2 2.26|943372|32|LS483481|CRISPRCasFinder,CRT 943372-943403 32 MT374854 Yersinia phage vB_YpM_6, complete genome 883-914 9 0.719
LS483481_2 2.26|943372|32|LS483481|CRISPRCasFinder,CRT 943372-943403 32 MT374853 Yersinia phage vB_YpM_5, complete genome 2308-2339 9 0.719
LS483481_1 1.1|924694|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924694-924725 32 NZ_KT937281 Edwardsiella ictaluri strain RUSVM-1 plasmid pEI2, complete sequence 935-966 10 0.688
LS483481_1 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 924755-924786 32 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 24503-24534 10 0.688
LS483481_1 1.7|925060|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925060-925091 32 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 55897-55928 10 0.688
LS483481_1 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925426-925457 32 NZ_CP032824 Arcobacter cryaerophilus ATCC 43158 plasmid pACRY43158, complete sequence 24667-24698 10 0.688
LS483481_1 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT 925426-925457 32 NZ_CP009417 Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence 396582-396613 10 0.688
LS483481_2 2.9|943249|33|LS483481|PILER-CR 943249-943281 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 243222-243254 10 0.697
LS483481_2 2.20|943006|32|LS483481|CRISPRCasFinder,CRT 943006-943037 32 NZ_CP013369 Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence 126933-126964 10 0.688
LS483481_2 2.24|943250|32|LS483481|CRISPRCasFinder,CRT 943250-943281 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 243222-243253 10 0.688

1. spacer 2.1|942761|33|LS483481|PILER-CR matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 0, identity: 1.0

gaaacatccgatcaaatactgcgttcgtttgag	CRISPR spacer
gaaacatccgatcaaatactgcgttcgtttgag	Protospacer
*********************************

2. spacer 2.5|943005|33|LS483481|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcagatgcctcccgtactgccgccgga	Protospacer
*********************************

3. spacer 2.5|943005|33|LS483481|PILER-CR matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcagatgcctcccgtactgccgccgga	Protospacer
*********************************

4. spacer 2.5|943005|33|LS483481|PILER-CR matches to NC_010391 (Salmonella phage Fels-1, complete genome) position: , mismatch: 0, identity: 1.0

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcagatgcctcccgtactgccgccgga	Protospacer
*********************************

5. spacer 2.10|943310|33|LS483481|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
ggcctgccgtctttttattgaggtctgtaaacc	Protospacer
*********************************

6. spacer 2.12|943432|33|LS483481|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

ggagttattgtcactcgtcagtgataattttct	CRISPR spacer
ggagttattgtcactcgtcagtgataattttct	Protospacer
*********************************

7. spacer 2.16|942762|32|LS483481|CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 0, identity: 1.0

aaacatccgatcaaatactgcgttcgtttgag	CRISPR spacer
aaacatccgatcaaatactgcgttcgtttgag	Protospacer
********************************

8. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcagatgcctcccgtactgccgccgga	Protospacer
********************************

9. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcagatgcctcccgtactgccgccgga	Protospacer
********************************

10. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NC_010391 (Salmonella phage Fels-1, complete genome) position: , mismatch: 0, identity: 1.0

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcagatgcctcccgtactgccgccgga	Protospacer
********************************

11. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gcctgccgtctttttattgaggtctgtaaacc	Protospacer
********************************

12. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 0, identity: 1.0

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattgtcactcgtcagtgataattttct	Protospacer
********************************

13. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 0, identity: 1.0

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattgtcactcgtcagtgataattttct	Protospacer
********************************

14. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 0, identity: 1.0

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattgtcactcgtcagtgataattttct	Protospacer
********************************

15. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 0, identity: 1.0

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattgtcactcgtcagtgataattttct	Protospacer
********************************

16. spacer 1.9|925182|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

caattgcgttcttgcttatgcccagcgactta	CRISPR spacer
caattgcgttcttgcttatgcccagcgactga	Protospacer
****************************** *

17. spacer 2.4|942944|33|LS483481|PILER-CR matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 1, identity: 0.97

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaaag	Protospacer
**************.******************

18. spacer 2.5|943005|33|LS483481|PILER-CR matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 1, identity: 0.97

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcagatgcctcccgtactgccgccggc	Protospacer
******************************** 

19. spacer 2.6|943066|33|LS483481|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

ggattggcccttagataacgggagatcaagcgc	CRISPR spacer
ggattggcccttagataacgggagatcaagtgc	Protospacer
******************************.**

20. spacer 2.9|943249|33|LS483481|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

gacaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
gacaaaatcggcggcccgatcgccggcgctgac	Protospacer
*****************.***************

21. spacer 2.12|943432|33|LS483481|PILER-CR matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 1, identity: 0.97

ggagttattgtcactcgtcagtgataattttct	CRISPR spacer
tgagttattgtcactcgtcagtgataattttct	Protospacer
 ********************************

22. spacer 2.12|943432|33|LS483481|PILER-CR matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 1, identity: 0.97

ggagttattgtcactcgtcagtgataattttct	CRISPR spacer
tgagttattgtcactcgtcagtgataattttct	Protospacer
 ********************************

23. spacer 2.12|943432|33|LS483481|PILER-CR matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 1, identity: 0.97

ggagttattgtcactcgtcagtgataattttct	CRISPR spacer
tgagttattgtcactcgtcagtgataattttct	Protospacer
 ********************************

24. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 1, identity: 0.969

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaaag	Protospacer
*************.******************

25. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 1, identity: 0.969

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcagatgcctcccgtactgccgccggc	Protospacer
******************************* 

26. spacer 2.21|943067|32|LS483481|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

gattggcccttagataacgggagatcaagcgc	CRISPR spacer
gattggcccttagataacgggagatcaagtgc	Protospacer
*****************************.**

27. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
acaaaatcggcggcccgatcgccggcgctgac	Protospacer
****************.***************

28. spacer 2.2|942822|33|LS483481|PILER-CR matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.939

gcgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
gcgtatttttgaactggccagtgctaccgatgc	Protospacer
*********************.**.********

29. spacer 2.5|943005|33|LS483481|PILER-CR matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 2, identity: 0.939

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcagatgtctcccgtactgccgccggc	Protospacer
*************.****************** 

30. spacer 2.5|943005|33|LS483481|PILER-CR matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 2, identity: 0.939

gcgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgaatgcggacgcctcccgtactgccgccgga	Protospacer
********.**.*********************

31. spacer 2.17|942823|32|LS483481|CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938

cgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
cgtatttttgaactggccagtgctaccgatgc	Protospacer
********************.**.********

32. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 2, identity: 0.938

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcagatgtctcccgtactgccgccggc	Protospacer
************.****************** 

33. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 2, identity: 0.938

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
cgaatgcggacgcctcccgtactgccgccgga	Protospacer
*******.**.*********************

34. spacer 2.3|942883|33|LS483481|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909

gggttacgcgggcgtctgttaaagagtcctcgt	CRISPR spacer
gggttgcgcgggcgtctgttgaagagtcctcgc	Protospacer
*****.**************.***********.

35. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

36. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

37. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

38. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

39. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

40. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgaata	Protospacer
**************.**************** .

41. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP022492 (Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggggtttcccggaggcattctgatgacaa	Protospacer
**************.*************** *.

42. spacer 2.12|943432|33|LS483481|PILER-CR matches to NZ_CP014707 (Salmonella enterica subsp. enterica serovar Anatum strain USMARC-1735 plasmid pSAN1-1735, complete sequence) position: , mismatch: 3, identity: 0.909

ggagttattgtcactcgtcagtgataattttct	CRISPR spacer
ggagttattgtcactggtcagtgatagtttttt	Protospacer
*************** **********.****.*

43. spacer 2.18|942884|32|LS483481|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

ggttacgcgggcgtctgttaaagagtcctcgt	CRISPR spacer
ggttgcgcgggcgtctgttgaagagtcctcgc	Protospacer
****.**************.***********.

44. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

45. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

46. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

47. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

48. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

49. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgaata	Protospacer
*************.**************** .

50. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP022492 (Salmonella enterica subsp. enterica serovar Saintpaul strain SA20031783 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggggtttcccggaggcattctgatgacaa	Protospacer
*************.*************** *.

51. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP014707 (Salmonella enterica subsp. enterica serovar Anatum strain USMARC-1735 plasmid pSAN1-1735, complete sequence) position: , mismatch: 3, identity: 0.906

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattgtcactggtcagtgatagtttttt	Protospacer
************** **********.****.*

52. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 4, identity: 0.879

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggagtttcccggaggcattctgatgaaga	Protospacer
******.*******.****************..

53. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 4, identity: 0.879

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggagtttcccggaggcattctgatgaaga	Protospacer
******.*******.****************..

54. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 4, identity: 0.879

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggagtttcccggaggcattctgatgaaga	Protospacer
******.*******.****************..

55. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 4, identity: 0.879

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggagtttcccggaggcattctgatgaaga	Protospacer
******.*******.****************..

56. spacer 2.4|942944|33|LS483481|PILER-CR matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 4, identity: 0.879

ggccggggtttcccagaggcattctgatgaaag	CRISPR spacer
ggccggagtttcccggaggcattctgatgaaga	Protospacer
******.*******.****************..

57. spacer 2.10|943310|33|LS483481|PILER-CR matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

58. spacer 2.10|943310|33|LS483481|PILER-CR matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

59. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

60. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

61. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

62. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

63. spacer 2.10|943310|33|LS483481|PILER-CR matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

64. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

65. spacer 2.10|943310|33|LS483481|PILER-CR matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 4, identity: 0.879

ggcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
gtcctgccgtcttcttattgaggtcggtaaatc	Protospacer
* ***********.*********** *****.*

66. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 4, identity: 0.875

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggagtttcccggaggcattctgatgaaga	Protospacer
*****.*******.****************..

67. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 4, identity: 0.875

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggagtttcccggaggcattctgatgaaga	Protospacer
*****.*******.****************..

68. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 4, identity: 0.875

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggagtttcccggaggcattctgatgaaga	Protospacer
*****.*******.****************..

69. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 4, identity: 0.875

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggagtttcccggaggcattctgatgaaga	Protospacer
*****.*******.****************..

70. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 4, identity: 0.875

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gccggagtttcccggaggcattctgatgaaga	Protospacer
*****.*******.****************..

71. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

72. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

73. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

74. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

75. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

76. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

77. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

78. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

79. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 4, identity: 0.875

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcctgccgtcttcttattgaggtcggtaaatc	Protospacer
 ***********.*********** *****.*

80. spacer 1.10|925243|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to MH001450 (Mycobacterium phage Jeon, complete genome) position: , mismatch: 6, identity: 0.812

atttcaaacactccgggtctgccagcgcctca	CRISPR spacer
agtccatccactccgggtcttccagctcctca	Protospacer
* *.**  ************ ***** *****

81. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 7, identity: 0.781

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cgtctcgaccggtagcttgccggaggcttggt	Protospacer
** ********* ********** . * *** 

82. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 7, identity: 0.781

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cgtctcgaccggtagcttgccggaggcttggt	Protospacer
** ********* ********** . * *** 

83. spacer 1.3|924816|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to MN694526 (Marine virus AFVG_250M936, complete genome) position: , mismatch: 7, identity: 0.781

caatcatctgattttttatcattgagagatat	CRISPR spacer
atatcatctaattttttatcattaagaagaat	Protospacer
  *******.*************.***.. **

84. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
ccggcctcggcggcccaatcgctggcgctggc	Protospacer
 *..  ****************.*******.*

85. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP021139 (Sulfuriferula sp. AH1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tccagcacggcggcccaatcgcgggcgctgcc	Protospacer
 * *.  *************** ******* *

86. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

87. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

88. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

89. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

90. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

91. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

92. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

93. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

94. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

95. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

96. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

97. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

98. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

99. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

100. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

101. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

102. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

103. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tgagcaccggccgcccaatcgccggcgctgtc	Protospacer
  *. *.**** ****************** *

104. spacer 2.27|943433|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 7, identity: 0.781

gagttattgtcactcgtcagtgataattttct	CRISPR spacer
gagttattattactcgtcagtgaaagcctttt	Protospacer
********.*.************ *...**.*

105. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
ctctacgaccgggagctcgccggcatcgaagg	Protospacer
*  . ************.********** .*.

106. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
ctctacgaccgggagctcgccggcatcgaagg	Protospacer
*  . ************.********** .*.

107. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cccggcgccctggagcttgccggcatcgtgcg	Protospacer
*    ** ** ******************* .

108. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
ctctacgaccgggagctcgccggcatcgaagg	Protospacer
*  . ************.********** .*.

109. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cccggcgccctggagcttgccggcatcgtgcg	Protospacer
*    ** ** ******************* .

110. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cggctcgactgggtgcttgccgggctgctgac	Protospacer
*********.*** *********  *  **. 

111. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032928 (Agrobacterium tumefaciens strain 1D1460 plasmid pAt1D1460, complete sequence) position: , mismatch: 8, identity: 0.75

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cccgtcgatcgggagcttgccggcttcacggc	Protospacer
*   ****.*************** **..** 

112. spacer 1.8|925121|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

---cggccgtagcgccgctcagtccgggggatggt	CRISPR spacer
gttcgagc---acgccgctcaagccgggggatggt	Protospacer
   **. *   .*********. ************

113. spacer 1.9|925182|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028385 (Providencia heimbachae strain 99101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

caattgcgttcttgcttatgcccagcgactta	CRISPR spacer
caattgcgttctggcttacgccctgggtatcg	Protospacer
************ *****.**** * *  *..

114. spacer 2.9|943249|33|LS483481|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

gacaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
cccggcctcggcggcccaatcgctggcgctggc	Protospacer
  *..  ****************.*******.*

115. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP050076 (Enterobacter kobei strain 070 plasmid p070_B, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

116. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP041049 (Citrobacter sp. CF971 plasmid pBM527-3, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

117. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP022300 (Acinetobacter johnsonii strain IC001 plasmid pIC001B, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .  *************** ******* *

118. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KX912255 (Enterobacter cloacae strain H140960786 plasmid pJF-786, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

119. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KX863568 (Citrobacter freundii strain AtetA plasmid pLNU-11, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

120. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_022346 (Pseudomonas aeruginosa strain ST308 plasmid pCOL-1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

121. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to LC486677 (Serratia marcescens MRY16-414SMA plasmid pMRY16-414SMA_2 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

122. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KU578314 (Pseudomonas aeruginosa strain 10265 plasmid p10265-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

123. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_KR014106 (Aeromonas hydrophila strain WCHAH01 plasmid pKPC2, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

124. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to MN539620 (Citrobacter sp. strain 172116965 plasmid p116965-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

125. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

126. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to MN436715 (Klebsiella pneumoniae strain NMI4661/17 plasmid pKRA-GES-5, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

127. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to LC155906 (Achromobacter xylosoxidans plasmid pKUN4507_1 DNA, complete sequence, strain: KUN4507) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcctgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

128. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP027855 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-3, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

129. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP038596 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

130. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_AP019194 (Aeromonas hydrophila strain GSH8-2 plasmid pGSH8-2, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

131. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to KM659090 (Achromobacter sp. LM16 plasmid pLM16A1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

132. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_AP019197 (Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-2, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

133. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to DQ839391 (Uncultured bacterium plasmid pRSB105, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

134. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to MK050973 (Citrobacter freundii plasmid pCRE12-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

135. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP028566 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pKPC2_045096, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

136. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP019671 (Burkholderia cenocepacia strain VC12308 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

137. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP018968 (Escherichia coli strain Ecol_542 plasmid pEC542_KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

138. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_LS998784 (Pseudomonas aeruginosa isolate 1 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

139. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP026224 (Aeromonas sp. ASNIH3 plasmid pKPC-cd17, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

140. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to MN477223 (Enterobacter cloacae strain 30860 plasmid p30860-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

141. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP040685 (Pseudomonas aeruginosa strain C79 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

142. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_019267 (Serratia marcescens plasmid pRIO-5, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

143. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_011604 (Salmonella enterica subsp. enterica serovar Westhampton plasmid pWES-1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

144. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_005909 (Pseudomonas alcaligenes plasmid pRA2, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

145. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

146. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_LT992437 (Citrobacter freundii isolate CF121SC21 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

147. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MH909348 (Klebsiella pneumoniae strain A1705 plasmid pA1705-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

148. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MH909350 (Klebsiella pneumoniae strain A1706 plasmid pA1706-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

149. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MF497782 (Morganella morganii strain Mmo-37590cz plasmid pMMO-37590cz, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

150. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MH624130 (Aeromonas taiwanensis strain L186 plasmid p186-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

151. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MH919378 (Citrobacter braakii strain CRE3 plasmid pCRE3-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

152. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP032895 (Enterobacter kobei strain WCHEK045523 plasmid pKPC2_045523, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

153. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MF168945 (Pseudomonas aeruginosa strain FFUP_PS_35 plasmid pJB35, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcggcccaatcgcgggcgctgcc	Protospacer
 *  .  *************** ******* *

154. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MG558000 (Citrobacter freundii strain Cfr-33795cz plasmid pCfr-33795cz, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcggacggcggcccaatcgcgggcgctgcc	Protospacer
 *. .. *************** ******* *

155. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
ccgcgatcggcggcccgatcggcggcgctatc	Protospacer
 *. .***********.**** *******. *

156. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
gcaggatcggcggcacaatcgtcggcgcattc	Protospacer
.**..********* ******.******   *

157. spacer 1.1|924694|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 9, identity: 0.719

cccggttttaccgccaacactcactatattgt	CRISPR spacer
gccacagttaacgccaacactgactatattca	Protospacer
 **.   *** ********** ********  

158. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.719

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
ttcgcggaccgggagttcgccggcatcgtggc	Protospacer
.   . *********.*.************* 

159. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.719

--cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
accga--ggacggggaacttgccggcatcgtccg	Protospacer
  **.   *** ****.**************  .

160. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
cccggcgccctggagcttgccggcatcgtccg	Protospacer
*    ** ** ******************  .

161. spacer 1.11|925304|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NC_015851 (Acidithiobacillus caldus SM-1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

cggcggcggacgccgctcagatagccaaaacc	CRISPR spacer
gggcggcggaagccgctcagatagcaggcgat	Protospacer
 ********* ************** .. . .

162. spacer 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 9, identity: 0.719

cgttttttttatttgtactattgtcagtaccc	CRISPR spacer
atctttttttatttgttctattgccagtttaa	Protospacer
  .************* ******.**** .  

163. spacer 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to KX156762 (Staphylococcus phage vB_SauS_IMEP5, complete genome) position: , mismatch: 9, identity: 0.719

cgttttttttatttgtactattgtcagtaccc	CRISPR spacer
ctctttttttatttgtacaagtgtcaaacacg	Protospacer
* .*************** * *****.   * 

164. spacer 1.21|925914|32|LS483481|CRISPRCasFinder,CRT matches to NC_047851 (Brevibacterium phage LuckyBarnes, complete genome) position: , mismatch: 9, identity: 0.719

ccggatgaaaacgcctacccggaagactacga	CRISPR spacer
gcagatgaaatcgcctaccgggaagagctggc	Protospacer
 *.******* ******** ****** .  * 

165. spacer 2.2|942822|33|LS483481|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.727

gcgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
gaatttttttgaactggccgtcgccaccgcaat	Protospacer
* .* **************. ********  ..

166. spacer 2.9|943249|33|LS483481|PILER-CR matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 9, identity: 0.727

gacaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
accgcgatcggcggcccgatcggcggcgctatc	Protospacer
. *. .***********.**** *******. *

167. spacer 2.17|942823|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

cgtatttttgaactggccagcgccaccgatgc	CRISPR spacer
aatttttttgaactggccgtcgccaccgcaat	Protospacer
 .* **************. ********  ..

168. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 9, identity: 0.719

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gaaaaagtttcccggagacattctgatgagaa	Protospacer
*  ...*******.***.***********.*.

169. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 9, identity: 0.719

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gaaaaagtttcccggagacattctgatgagaa	Protospacer
*  ...*******.***.***********.*.

170. spacer 2.19|942945|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 9, identity: 0.719

gccggggtttcccagaggcattctgatgaaag	CRISPR spacer
gaaaaagtttcccggagacattctgatgagaa	Protospacer
*  ...*******.***.***********.*.

171. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NZ_LR723669 (Rhizobium sp. Khangiran2 plasmid 2) position: , mismatch: 9, identity: 0.719

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
catcgacccatgcctccgatactgccgccgga	Protospacer
*.   .*  ******** .*************

172. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to MK392366 (Streptomyces phage Janus, complete genome) position: , mismatch: 9, identity: 0.719

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gacaggaagctgcctgccgtactgccgccgat	Protospacer
 . * * ** ***** **************. 

173. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP034654 (Xanthomonas vasicola pv. arecae strain NCPPB 2649 plasmid pXCARECAE29, complete sequence) position: , mismatch: 9, identity: 0.719

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcgcgcacggcagcccaatcgcgggcgctgcc	Protospacer
 *. .  ****.********** ******* *

174. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP015374 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 3, complete sequence) position: , mismatch: 9, identity: 0.719

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggccgcccaatcgcgggcgctgcc	Protospacer
 *  .  **** ********** ******* *

175. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NC_016053 (Xanthomonas arboricola pv. pruni str. CFBP 5530 plasmid pXap41, complete sequence) position: , mismatch: 9, identity: 0.719

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggccgcccaatcgcgggcgctgcc	Protospacer
 *  .  **** ********** ******* *

176. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_LR594694 (Variovorax sp. WDL1 plasmid 6) position: , mismatch: 9, identity: 0.719

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggccgcccaatcgcgggcgctgcc	Protospacer
 *  .  **** ********** ******* *

177. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_MF344578 (Pseudomonas aeruginosa strain 60512 plasmid p60512-IMP, complete sequence) position: , mismatch: 9, identity: 0.719

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
tcccgcacggcagcccaatcgcgggcgctgcc	Protospacer
 *  .  ****.********** ******* *

178. spacer 2.25|943311|32|LS483481|CRISPRCasFinder,CRT matches to HG796856 (Uncultured bacterium plasmid pRGF00250) position: , mismatch: 9, identity: 0.719

gcctgccgtctttttattgaggtctgtaaacc	CRISPR spacer
tcgttttttcttttttttgaggtcagtaaaca	Protospacer
 * * .. ******* ******** ****** 

179. spacer 2.26|943372|32|LS483481|CRISPRCasFinder,CRT matches to MT374854 (Yersinia phage vB_YpM_6, complete genome) position: , mismatch: 9, identity: 0.719

taatcattttgtttaaatcccggatcacctcc	CRISPR spacer
tcgccattttgtttaaatcccgtgtcattatc	Protospacer
* ..****************** .***.. .*

180. spacer 2.26|943372|32|LS483481|CRISPRCasFinder,CRT matches to MT374853 (Yersinia phage vB_YpM_5, complete genome) position: , mismatch: 9, identity: 0.719

taatcattttgtttaaatcccggatcacctcc	CRISPR spacer
tcgccattttgtttaaatcccgtgtcattatc	Protospacer
* ..****************** .***.. .*

181. spacer 1.1|924694|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT937281 (Edwardsiella ictaluri strain RUSVM-1 plasmid pEI2, complete sequence) position: , mismatch: 10, identity: 0.688

cccggttttaccgccaacactcactatattgt	CRISPR spacer
actttttttaccgccaacactccctctaactg	Protospacer
 *.  ***************** ** ** .  

182. spacer 1.2|924755|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 10, identity: 0.688

cggctcgaccgggagcttgccggcatcgtgga	CRISPR spacer
ttcctcggccgggaacttgccggcataacgct	Protospacer
.  ****.******.*********** ..*  

183. spacer 1.7|925060|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 10, identity: 0.688

gagcacttttactgtaggacttgtatgaatct	CRISPR spacer
cagcacttttactgtcggccttgtctccgggg	Protospacer
 ************** ** ***** *  .   

184. spacer 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032824 (Arcobacter cryaerophilus ATCC 43158 plasmid pACRY43158, complete sequence) position: , mismatch: 10, identity: 0.688

cgttttttttatttgtactattgtcagtaccc	CRISPR spacer
tattttttttatttttactaatgtcttttttt	Protospacer
..************ ***** ****  * ...

185. spacer 1.13|925426|32|LS483481|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

cgttttttttatttgtactattgtcagtaccc	CRISPR spacer
ttctttttttattttgactattgtcaacaata	Protospacer
. .***********  **********..* . 

186. spacer 2.9|943249|33|LS483481|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

gacaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
gctggtctcggtggcccaatcgctggcgctgga	Protospacer
* ...  ****.***********.*******. 

187. spacer 2.20|943006|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP013369 (Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence) position: , mismatch: 10, identity: 0.688

cgaatgcagatgcctcccgtactgccgccgga	CRISPR spacer
gcgccgacgatgccgcccgtgctgccgccggt	Protospacer
  . .*  ****** *****.********** 

188. spacer 2.24|943250|32|LS483481|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

acaaaatcggcggcccaatcgccggcgctgac	CRISPR spacer
ctggtctcggtggcccaatcgctggcgctgga	Protospacer
 ...  ****.***********.*******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1647477 : 1656649 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_2 1723878 : 1734385 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 1912515 : 1968071 59 Enterobacteria_phage(23.53%) terminase,integrase,transposase,tRNA,protease attL 1918901:1918915|attR 1943030:1943044
DBSCAN-SWA_4 2596268 : 2632534 41 Edwardsiella_phage(22.22%) terminase,integrase,lysis,transposase,holin,tail attL 2584408:2584422|attR 2626551:2626565
DBSCAN-SWA_5 2635645 : 2651235 22 Salmonella_phage(29.41%) NA NA
DBSCAN-SWA_6 3246773 : 3281695 50 Salmonella_phage(38.3%) coat,integrase,capsid,head,holin,portal,tail attL 3238545:3238561|attR 3287098:3287114
DBSCAN-SWA_7 3311818 : 3371061 52 Bacillus_phage(25.0%) transposase,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage