Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483482 Staphylococcus lugdunensis strain NCTC12217 genome assembly, chromosome: 1 4 crisprs WYL,csa3,DEDDh,cas3,DinG 2 2 7 0

Results visualization

1. LS483482
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483482_1 739260-739344 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483482_2 1028020-1028104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483482_3 1684419-1684504 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483482_4 2191356-2191445 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 LS483482.1 1785495-1785525 1 0.968
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 LS483482.1 781915-781945 2 0.935
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 LS483482.1 1819283-1819313 2 0.935
LS483482_3 3.1|1684448|28|LS483482|CRISPRCasFinder 1684448-1684475 28 LS483482.1 1804266-1804293 2 0.929

1. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to position: 1785495-1785525, mismatch: 1, identity: 0.968

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
ggcccccaacacaaagaaatgcatcaagcat	Protospacer
*********************** *******

2. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to position: 781915-781945, mismatch: 2, identity: 0.935

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
gggccccaacaaaaagaaatgcaacaagcat	Protospacer
** ******** *******************

3. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to position: 1819283-1819313, mismatch: 2, identity: 0.935

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
gggccccaacaaaaagaaatgcaacaagcat	Protospacer
** ******** *******************

4. spacer 3.1|1684448|28|LS483482|CRISPRCasFinder matches to position: 1804266-1804293, mismatch: 2, identity: 0.929

ggggccccaacaaagagaatttcgaaat	CRISPR spacer
ggggccccaacaaagaggctttcgaaat	Protospacer
*****************. *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483482_2 2.1|1028048|29|LS483482|CRISPRCasFinder 1028048-1028076 29 NC_018265 Melissococcus plutonius DAT561 plasmid 1, complete sequence 120055-120083 6 0.793
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 NC_007058 Staphylococcus phage ROSA, complete genome 41574-41604 8 0.742
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 KT186243 Staphylococcus phage vB_SauS_phi2, complete genome 37495-37525 8 0.742
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 AY954955 Bacteriophage 42e, complete genome 41355-41385 8 0.742
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 AY954961 Bacteriophage ROSA, complete genome 41574-41604 8 0.742
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 NC_007052 Staphylococcus phage 42e, complete genome 41355-41385 8 0.742
LS483482_1 1.1|739287|31|LS483482|CRISPRCasFinder 739287-739317 31 AP013478 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-U-MedDCM-OCT-S26-C62 18066-18096 9 0.71
LS483482_2 2.1|1028048|29|LS483482|CRISPRCasFinder 1028048-1028076 29 MT774376 CrAssphage cr55_1, complete genome 42412-42440 9 0.69
LS483482_2 2.1|1028048|29|LS483482|CRISPRCasFinder 1028048-1028076 29 MT774380 CrAssphage cr1_1, complete genome 46180-46208 9 0.69

1. spacer 2.1|1028048|29|LS483482|CRISPRCasFinder matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.793

caaagactttccaaaagaaagtccacgaa	CRISPR spacer
aaaagactttccataagaaagtctaaata	Protospacer
 ************ *********.* . *

2. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to NC_007058 (Staphylococcus phage ROSA, complete genome) position: , mismatch: 8, identity: 0.742

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
agttaccaacacaaagaaacgcaccaaggaa	Protospacer
.*.. **************.*** **** * 

3. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to KT186243 (Staphylococcus phage vB_SauS_phi2, complete genome) position: , mismatch: 8, identity: 0.742

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
agttaccaacacaaagaaacgcaccaaggaa	Protospacer
.*.. **************.*** **** * 

4. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to AY954955 (Bacteriophage 42e, complete genome) position: , mismatch: 8, identity: 0.742

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
agttaccaacacaaagaaacgcaccaaggaa	Protospacer
.*.. **************.*** **** * 

5. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to AY954961 (Bacteriophage ROSA, complete genome) position: , mismatch: 8, identity: 0.742

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
agttaccaacacaaagaaacgcaccaaggaa	Protospacer
.*.. **************.*** **** * 

6. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to NC_007052 (Staphylococcus phage 42e, complete genome) position: , mismatch: 8, identity: 0.742

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
agttaccaacacaaagaaacgcaccaaggaa	Protospacer
.*.. **************.*** **** * 

7. spacer 1.1|739287|31|LS483482|CRISPRCasFinder matches to AP013478 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-U-MedDCM-OCT-S26-C62) position: , mismatch: 9, identity: 0.71

ggcccccaacacaaagaaatgcaacaagcat	CRISPR spacer
gatgagttacataaagaaatgcaaaaagcat	Protospacer
*..   . ***.************ ******

8. spacer 2.1|1028048|29|LS483482|CRISPRCasFinder matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 9, identity: 0.69

caaagactttccaaaagaaagtccacgaa	CRISPR spacer
taaagactttcctaaagaaagtatttatc	Protospacer
.*********** ********* . ..  

9. spacer 2.1|1028048|29|LS483482|CRISPRCasFinder matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.69

caaagactttccaaaagaaagtccacgaa	CRISPR spacer
taaagactttcctaaagaaagtatttatc	Protospacer
.*********** ********* . ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 580611 : 605143 25 Bacillus_phage(40.0%) tRNA,holin,protease NA
DBSCAN-SWA_2 1149272 : 1179525 32 Staphylococcus_phage(96.15%) tRNA NA
DBSCAN-SWA_3 1296242 : 1305261 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_4 1430932 : 1439629 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_5 1844149 : 1852619 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2129550 : 2147347 16 uncultured_Caudovirales_phage(58.33%) NA NA
DBSCAN-SWA_7 2161869 : 2168490 8 Pandoravirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage