Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483486 Haemophilus influenzae strain NCTC12194 genome assembly, chromosome: 1 3 crisprs DinG,DEDDh,cas3,WYL 2 0 7 0

Results visualization

1. LS483486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483486_1 381150-381234 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483486_2 1170184-1170332 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483486_3 1199048-1199135 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LS483486_1 1.1|381173|39|LS483486|CRISPRCasFinder 381173-381211 39 LS483486.1 437771-437809 1 0.974
LS483486_4 4.1|1268065|49|LS483486|CRISPRCasFinder 1268065-1268113 49 LS483486.1 1268029-1268077 1 0.98

1. spacer 1.1|381173|39|LS483486|CRISPRCasFinder matches to position: 437771-437809, mismatch: 1, identity: 0.974

gcccaccaaaatatcttacgattgtttgttggtgggcta	CRISPR spacer
gcccaccaaaatatctcacgattgtttgttggtgggcta	Protospacer
****************.**********************

2. spacer 4.1|1268065|49|LS483486|CRISPRCasFinder matches to position: 1268029-1268077, mismatch: 1, identity: 0.98

tgtgcagtagtagcaggagctgctgcctgtggtgcttgtgcagtagtag	CRISPR spacer
tgtgcagtagtatcaggagctgctgcctgtggtgcttgtgcagtagtag	Protospacer
************ ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 647255 : 701117 82 Mannheimia_phage(10.64%) integrase,holin,tail,terminase,plate attL 642051:642067|attR 678842:678858
DBSCAN-SWA_2 749795 : 756450 9 Bacillus_virus(16.67%) NA NA
DBSCAN-SWA_3 768114 : 772436 9 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_4 931022 : 1009035 75 Haemophilus_virus(71.43%) integrase,protease,tail,capsid,holin,tRNA,terminase,portal attL 924750:924767|attR 966482:966499
DBSCAN-SWA_5 1300600 : 1358070 73 Mannheimia_phage(48.65%) integrase,lysis,protease,tail,capsid,holin,tRNA,terminase,head,portal,plate attL 1291199:1291215|attR 1361568:1361584
DBSCAN-SWA_6 1464332 : 1495077 50 Mannheimia_phage(22.58%) integrase,terminase attL 1487087:1487103|attR 1501183:1501199
DBSCAN-SWA_7 1728686 : 1737195 8 Bacillus_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage