Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483503 Mycoplasma mycoides subsp. capri strain GM12 genome assembly, chromosome: omosome 3 crisprs NA 0 1 1 0

Results visualization

1. LS483503
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483503_1 136012-136095 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483503_2 224859-224947 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483503_3 253986-254082 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483503_2 2.1|224886|35|LS483503|CRISPRCasFinder 224886-224920 35 NZ_CP013682 Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence 13914-13948 9 0.743
LS483503_2 2.1|224886|35|LS483503|CRISPRCasFinder 224886-224920 35 NZ_CP013295 Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence 24630-24664 9 0.743
LS483503_2 2.1|224886|35|LS483503|CRISPRCasFinder 224886-224920 35 MN812211 Flavobacterium phage vB_FspS_laban6-1, complete genome 22167-22201 11 0.686

1. spacer 2.1|224886|35|LS483503|CRISPRCasFinder matches to NZ_CP013682 (Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence) position: , mismatch: 9, identity: 0.743

ttgttcattataattttatcataaaaatacctacg	CRISPR spacer
tcatctgctataatttcatcataaaaataccaacc	Protospacer
*..*....********.************** ** 

2. spacer 2.1|224886|35|LS483503|CRISPRCasFinder matches to NZ_CP013295 (Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence) position: , mismatch: 9, identity: 0.743

ttgttcattataattttatcataaaaatacctacg	CRISPR spacer
tcatctgctataatttcatcataaaaataccaacc	Protospacer
*..*....********.************** ** 

3. spacer 2.1|224886|35|LS483503|CRISPRCasFinder matches to MN812211 (Flavobacterium phage vB_FspS_laban6-1, complete genome) position: , mismatch: 11, identity: 0.686

ttgttcattataattttatcataaaaatacctacg	CRISPR spacer
aattttattataattttataataaaaatcaacaat	Protospacer
   **.************* ********   .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 827855 : 841899 13 Lactococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage