Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS483514 Mycoplasma mycoides subsp. capri strain GM12 genome assembly, chromosome: omosome 3 crisprs NA 0 1 1 0

Results visualization

1. LS483514
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483514_1 140423-140506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483514_2 229270-229360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS483514_3 258397-258493 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS483514_2 2.1|229299|33|LS483514|CRISPRCasFinder 229299-229331 33 NZ_CP013682 Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence 13914-13946 8 0.758
LS483514_2 2.1|229299|33|LS483514|CRISPRCasFinder 229299-229331 33 NZ_CP013295 Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence 24630-24662 8 0.758
LS483514_2 2.1|229299|33|LS483514|CRISPRCasFinder 229299-229331 33 MN812211 Flavobacterium phage vB_FspS_laban6-1, complete genome 22169-22201 9 0.727
LS483514_2 2.1|229299|33|LS483514|CRISPRCasFinder 229299-229331 33 CP019152 Acinetobacter lwoffii strain ZS207 plasmid pZS-2, complete sequence 8788-8820 9 0.727
LS483514_2 2.1|229299|33|LS483514|CRISPRCasFinder 229299-229331 33 MN693975 Marine virus AFVG_250M1117, complete genome 8793-8825 9 0.727

1. spacer 2.1|229299|33|LS483514|CRISPRCasFinder matches to NZ_CP013682 (Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence) position: , mismatch: 8, identity: 0.758

gttcattataattttatcataaaaatacctacg	CRISPR spacer
atctgctataatttcatcataaaaataccaacc	Protospacer
.*....********.************** ** 

2. spacer 2.1|229299|33|LS483514|CRISPRCasFinder matches to NZ_CP013295 (Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence) position: , mismatch: 8, identity: 0.758

gttcattataattttatcataaaaatacctacg	CRISPR spacer
atctgctataatttcatcataaaaataccaacc	Protospacer
.*....********.************** ** 

3. spacer 2.1|229299|33|LS483514|CRISPRCasFinder matches to MN812211 (Flavobacterium phage vB_FspS_laban6-1, complete genome) position: , mismatch: 9, identity: 0.727

gttcattataattttatcataaaaatacctacg	CRISPR spacer
ttttattataattttataataaaaatcaacaat	Protospacer
 **.************* ********   .*  

4. spacer 2.1|229299|33|LS483514|CRISPRCasFinder matches to CP019152 (Acinetobacter lwoffii strain ZS207 plasmid pZS-2, complete sequence) position: , mismatch: 9, identity: 0.727

gttcattataattttatcataaaaatacctacg	CRISPR spacer
gagcattataattttaacataaatatatgaatt	Protospacer
*  ************* ****** ***.  *. 

5. spacer 2.1|229299|33|LS483514|CRISPRCasFinder matches to MN693975 (Marine virus AFVG_250M1117, complete genome) position: , mismatch: 9, identity: 0.727

gttcattataattttatcataaa-----aatacctacg	CRISPR spacer
tttcattataatttgatcatcaaaaagtaatat-----	Protospacer
 ************* ***** **     ****.     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 911670 : 925714 13 Lactococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage