Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LS997976 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 genome assembly, plasmid: D23580_liv_pBT2 0 crisprs NA 0 0 0 0
LS997977 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 genome assembly, plasmid: D23580_liv_pBT3 0 crisprs NA 0 0 0 0
LS997974 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 genome assembly, plasmid: D23580_liv_pSLT-BT 0 crisprs NA 0 0 0 0
LS997973 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 genome assembly, chromosome: D23580_liv_o 3 crisprs NA 0 33 0 0
LS997975 Salmonella enterica subsp. enterica serovar Typhimurium strain D23580 genome assembly, plasmid: D23580_liv_pBT1 0 crisprs NA 0 0 0 0

Results visualization

1. LS997973
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS997973_1 2878555-2878664 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS997973_2 3069600-3071014 Orphan I-E
22 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LS997973_3 3087146-3088273 Orphan I-E
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LS997973_2 2.12|3070297|32|LS997973|PILER-CR 3070297-3070328 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
LS997973_2 2.12|3070297|32|LS997973|PILER-CR 3070297-3070328 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
LS997973_2 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder 3070282-3070313 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
LS997973_2 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder 3070282-3070313 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
LS997973_3 3.5|3087419|32|LS997973|CRISPRCasFinder,CRT 3087419-3087450 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
LS997973_3 3.5|3087419|32|LS997973|CRISPRCasFinder,CRT 3087419-3087450 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
LS997973_3 3.22|3087418|33|LS997973|PILER-CR 3087418-3087450 33 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67163 2 0.939
LS997973_3 3.22|3087418|33|LS997973|PILER-CR 3087418-3087450 33 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177959-177991 2 0.939
LS997973_2 2.12|3070297|32|LS997973|PILER-CR 3070297-3070328 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
LS997973_2 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder 3070282-3070313 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
LS997973_2 2.9|3070117|28|LS997973|PILER-CR 3070117-3070144 28 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 337987-338014 5 0.821
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387378 5 0.844
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461590 5 0.844
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599340-599371 5 0.844
LS997973_3 3.31|3087968|33|LS997973|PILER-CR 3087968-3088000 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387379 5 0.848
LS997973_3 3.31|3087968|33|LS997973|PILER-CR 3087968-3088000 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461591 5 0.848
LS997973_3 3.31|3087968|33|LS997973|PILER-CR 3087968-3088000 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599339-599371 5 0.848
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 121315-121346 6 0.812
LS997973_2 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR 3070056-3070087 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
LS997973_2 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR 3070056-3070087 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
LS997973_2 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR 3070056-3070087 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
LS997973_2 2.16|3070541|32|LS997973|PILER-CR 3070541-3070572 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
LS997973_2 2.18|3070663|32|LS997973|PILER-CR 3070663-3070694 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
LS997973_2 2.18|3070663|32|LS997973|PILER-CR 3070663-3070694 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
LS997973_2 2.30|3070526|32|LS997973|CRT,CRISPRCasFinder 3070526-3070557 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
LS997973_2 2.32|3070648|32|LS997973|CRT,CRISPRCasFinder 3070648-3070679 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
LS997973_2 2.32|3070648|32|LS997973|CRT,CRISPRCasFinder 3070648-3070679 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 135155-135186 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 195902-195933 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 581076-581107 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 122557-122588 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 529537-529568 7 0.781
LS997973_3 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT 3087969-3088000 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 327444-327475 7 0.781
LS997973_2 2.2|3069690|32|LS997973|CRISPRCasFinder,CRT,PILER-CR 3069690-3069721 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
LS997973_2 2.17|3070602|32|LS997973|PILER-CR 3070602-3070633 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
LS997973_2 2.31|3070587|32|LS997973|CRT,CRISPRCasFinder 3070587-3070618 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
LS997973_3 3.8|3087602|32|LS997973|CRISPRCasFinder,CRT 3087602-3087633 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
LS997973_3 3.8|3087602|32|LS997973|CRISPRCasFinder,CRT 3087602-3087633 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
LS997973_3 3.16|3088091|32|LS997973|CRISPRCasFinder,CRT 3088091-3088122 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79087-79118 8 0.75
LS997973_2 2.14|3070419|32|LS997973|PILER-CR 3070419-3070450 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
LS997973_2 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder 3070404-3070435 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
LS997973_3 3.10|3087725|32|LS997973|CRISPRCasFinder,CRT 3087725-3087756 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
LS997973_3 3.10|3087725|32|LS997973|CRISPRCasFinder,CRT 3087725-3087756 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
LS997973_3 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT 3087908-3087939 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
LS997973_3 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT 3087908-3087939 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
LS997973_3 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT 3087908-3087939 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
LS997973_3 3.25|3087601|33|LS997973|PILER-CR 3087601-3087633 33 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135501 9 0.727
LS997973_3 3.30|3087907|33|LS997973|PILER-CR 3087907-3087939 33 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353297-353329 9 0.727
LS997973_3 3.33|3088090|33|LS997973|PILER-CR 3088090-3088122 33 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462004-462036 9 0.727
LS997973_3 3.34|3088151|33|LS997973|PILER-CR 3088151-3088183 33 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79086-79118 9 0.727
LS997973_2 2.1|3069629|32|LS997973|CRISPRCasFinder,CRT 3069629-3069660 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
LS997973_2 2.1|3069629|32|LS997973|CRISPRCasFinder,CRT 3069629-3069660 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
LS997973_2 2.12|3070297|32|LS997973|PILER-CR 3070297-3070328 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
LS997973_2 2.20|3070785|32|LS997973|PILER-CR 3070785-3070816 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
LS997973_2 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder 3070282-3070313 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
LS997973_2 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder 3070770-3070801 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
LS997973_3 3.1|3087175|32|LS997973|CRISPRCasFinder,CRT 3087175-3087206 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
LS997973_3 3.4|3087358|32|LS997973|CRISPRCasFinder,CRT 3087358-3087389 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
LS997973_3 3.12|3087847|32|LS997973|CRISPRCasFinder,CRT 3087847-3087878 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 68697-68728 10 0.688
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 43950-43981 10 0.688
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 49131-49162 10 0.688
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 66631-66662 10 0.688
LS997973_3 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT 3088152-3088183 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 147167-147198 10 0.688
LS997973_3 3.27|3087724|33|LS997973|PILER-CR 3087724-3087756 33 MN693046 Marine virus AFVG_25M413, complete genome 4322-4354 10 0.697
LS997973_3 3.27|3087724|33|LS997973|PILER-CR 3087724-3087756 33 MN693008 Marine virus AFVG_117M9, complete genome 4315-4347 10 0.697

1. spacer 2.12|3070297|32|LS997973|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cggaccgatggggccaacatcgccgaacgtgg	Protospacer
.*******************************

2. spacer 2.12|3070297|32|LS997973|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggaccgatggggccaacatcgccgaatgtgg	Protospacer
***************************.****

3. spacer 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cggaccgatggggccaacatcgccgaacgtgg	Protospacer
.*******************************

4. spacer 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggaccgatggggccaacatcgccgaatgtgg	Protospacer
***************************.****

5. spacer 3.5|3087419|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969 

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

6. spacer 3.5|3087419|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969 

tgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
tgcgtagtgggctacctgaacttcacatatcc	Protospacer
******.*************************

7. spacer 3.22|3087418|33|LS997973|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 2, identity: 0.939 

ctgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
atgcgtagtgggctacctgaacttcacatatcc	Protospacer
 ******.*************************

8. spacer 3.22|3087418|33|LS997973|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 2, identity: 0.939 

ctgcgtaatgggctacctgaacttcacatatcc	CRISPR spacer
atgcgtagtgggctacctgaacttcacatatcc	Protospacer
 ******.*************************

9. spacer 2.12|3070297|32|LS997973|PILER-CR matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggacctatggggccaacatcaccgaacgtag	Protospacer
****** **************.********.*

10. spacer 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
tggacctatggggccaacatcaccgaacgtag	Protospacer
****** **************.********.*

11. spacer 2.9|3070117|28|LS997973|PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 5, identity: 0.821 

gatcgagtaacgtgcgctggaacgcgtc	CRISPR spacer
gattgaggaacgtgcgctggaacgatta	Protospacer
***.*** ****************  *

12. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

13. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

14. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

-agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
cagcggc-tatgccccagcggcaccacccgatc	Protospacer
 **** * .*** **** ***************

15. spacer 3.31|3087968|33|LS997973|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.848 

-cagcgccacatggcccaccggcaccacccgatc	CRISPR spacer
ccagcggc-tatgccccagcggcaccacccgatc	Protospacer
 ***** * .*** **** ***************

16. spacer 3.31|3087968|33|LS997973|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.848 

-cagcgccacatggcccaccggcaccacccgatc	CRISPR spacer
ccagcggc-tatgccccagcggcaccacccgatc	Protospacer
 ***** * .*** **** ***************

17. spacer 3.31|3087968|33|LS997973|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.848 

-cagcgccacatggcccaccggcaccacccgatc	CRISPR spacer
ccagcggc-tatgccccagcggcaccacccgatc	Protospacer
 ***** * .*** **** ***************

18. spacer 2.14|3070419|32|LS997973|PILER-CR matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  .

19. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
ccagccagtgccggtagtgcctgatgaaatgg	Protospacer
****  **********************  .

20. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812 

--agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
ccaacgc--catggccgacccgcaccacccgacc	Protospacer
  *.***  ******* *** ***********.*

21. spacer 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

22. spacer 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

23. spacer 2.8|3070056|32|LS997973|CRISPRCasFinder,CRT,PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781 

aatcact--gcgggggtatttagcggaaacggct	CRISPR spacer
--tcgctgcgcgggggtatttagcgaaatcgggg	Protospacer
  **.**  ****************.** ***

24. spacer 2.14|3070419|32|LS997973|PILER-CR matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

25. spacer 2.14|3070419|32|LS997973|PILER-CR matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

26. spacer 2.14|3070419|32|LS997973|PILER-CR matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

27. spacer 2.14|3070419|32|LS997973|PILER-CR matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

28. spacer 2.16|3070541|32|LS997973|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

29. spacer 2.18|3070663|32|LS997973|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

30. spacer 2.18|3070663|32|LS997973|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

31. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

32. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

33. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

34. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcagccagtgccggtagtgcctgatgaaatgg	Protospacer
 ***  **********************  .

35. spacer 2.30|3070526|32|LS997973|CRT,CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

ggcagcgggcgaggcaaacacattcggggcgt	CRISPR spacer
gccacggcgcgaggcaaacacattcaggtcgc	Protospacer
* **  * *****************.** **.

36. spacer 2.32|3070648|32|LS997973|CRT,CRISPRCasFinder matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

37. spacer 2.32|3070648|32|LS997973|CRT,CRISPRCasFinder matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

gaatctaatgcaacagatgaataaacacgtaa	CRISPR spacer
gcttctaatgcaatagatgaagaaacaccaat	Protospacer
*  **********.******* ******  *

38. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacccgatc--	CRISPR spacer
gccgccacatggcccaccgccaccagc--gtcgg	Protospacer
. ***************** ***** *  .**

39. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacccgatc--	CRISPR spacer
gccgccacatggcccaccgccaccagc--gtcgg	Protospacer
. ***************** ***** *  .**

40. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * **

41. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * **

42. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacc-cgatc	CRISPR spacer
cccgccacatggcccagcggctccatcgccat-	Protospacer
  ************** **** ***.* * **

43. spacer 3.14|3087969|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781 

agcgccacatggcccaccggcaccacccgatc	CRISPR spacer
agccccacatggcgcaccggcacggcactagc	Protospacer
*** ********* ********* .* * * *

44. spacer 2.2|3069690|32|LS997973|CRISPRCasFinder,CRT,PILER-CR matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75 

gcgaaatagtggggaaaaacccctggttaacc	CRISPR spacer
tttcaatattggggaaaaacccctcgttacct	Protospacer
 .  **** *************** **** *.

45. spacer 2.17|3070602|32|LS997973|PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.

46. spacer 2.31|3070587|32|LS997973|CRT,CRISPRCasFinder matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

ggtaatttctcatctaacagcct-----gtacgcctc	CRISPR spacer
ggtaatttcgcatcaaacagccttattagtat-----	Protospacer
********* **** ********     ***.

47. spacer 3.8|3087602|32|LS997973|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75 

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
ggcagaactgaataaaatgtctgatagtgaat	Protospacer
 .  ***************** ** *****

48. spacer 3.8|3087602|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

taacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
aaatgaactgaatacaatgtcagacacgcgcg	Protospacer
 **.********** ********* *   .**

49. spacer 3.16|3088091|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

taatggccacagtaagtcaaacggttctggaa	CRISPR spacer
cggtggccacagtaaggcacacggttcggcag	Protospacer
...************* ** ******* * *.

50. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 8, identity: 0.75 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
gctctcgtgtgttatatagttatttaatgata	Protospacer
*  ..** * ********************

51. spacer 2.14|3070419|32|LS997973|PILER-CR matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******

52. spacer 2.20|3070785|32|LS997973|PILER-CR matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719 

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.

53. spacer 2.28|3070404|32|LS997973|CRT,CRISPRCasFinder matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719 

ccagaaagtgccggtagtgcctgatgaacgac	CRISPR spacer
gcatccagcgccggtagtgccggatgaactca	Protospacer
 **   **.************ *******

54. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719 

tcccattcaccaacaacaatatcgccctgcaa----	CRISPR spacer
ccccaatcaccaacaataatatcgt----cagtgtt	Protospacer
.**** **********.*******.    **.

55. spacer 3.10|3087725|32|LS997973|CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

56. spacer 3.10|3087725|32|LS997973|CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719 

ggtaaagccacaccattttttattgacctcgc	CRISPR spacer
tctgaaaccacaccattttttgttgaccctaa	Protospacer
  *.**.**************.******...

57. spacer 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
gttcagtggacgaggagttcctcacccgcacc	Protospacer
 .   ************** **** ****  *

58. spacer 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

59. spacer 3.13|3087908|32|LS997973|CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719 

tcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
ttgggctggaccaggagttactccaccgcctt	Protospacer
*.*.  ***** *********** *****. .

60. spacer 3.25|3087601|33|LS997973|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 9, identity: 0.727 

ctaacgaactgaataaaatgtcagaaagtgacg	CRISPR spacer
tggcagaactgaataaaatgtctgatagtgaat	Protospacer
. .  ***************** ** *****

61. spacer 3.30|3087907|33|LS997973|PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.727 

ctcgacgtggacgaggagttactcaaccgctgc	CRISPR spacer
cgttcagtggacgaggagttcctcacccgcacc	Protospacer
* .   ************** **** ****  *

62. spacer 3.33|3088090|33|LS997973|PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727 

ctaatggccacagtaagtcaaacggttctggaa	CRISPR spacer
gcggtggccacagtaaggcacacggttcggcag	Protospacer
 ...************* ** ******* * *.

63. spacer 3.34|3088151|33|LS997973|PILER-CR matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 9, identity: 0.727 

cgagtccgggggttatatagttatttaatgagc	CRISPR spacer
tgctctcgtgtgttatatagttatttaatgata	Protospacer
.*  ..** * ********************

64. spacer 2.1|3069629|32|LS997973|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

65. spacer 2.1|3069629|32|LS997973|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

ttttcagcccttgtcgactgcggaacgcccct	CRISPR spacer
tccctcaccctcgtcgactgcggaccgcccgg	Protospacer
*.... .****.************ *****

66. spacer 2.12|3070297|32|LS997973|PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cacctggatgggggccacatcgccgaacgagt	Protospacer
..  . ******* * ************* *

67. spacer 2.20|3070785|32|LS997973|PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

68. spacer 2.20|3070785|32|LS997973|PILER-CR matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

69. spacer 2.20|3070785|32|LS997973|PILER-CR matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

70. spacer 2.20|3070785|32|LS997973|PILER-CR matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

71. spacer 2.20|3070785|32|LS997973|PILER-CR matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

72. spacer 2.26|3070282|32|LS997973|CRT,CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688 

tggaccgatggggccaacatcgccgaacgtgg	CRISPR spacer
cacctggatgggggccacatcgccgaacgagt	Protospacer
..  . ******* * ************* *

73. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

74. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

75. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

76. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

77. spacer 2.34|3070770|32|LS997973|CRT,CRISPRCasFinder matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688 

tcccattcaccaacaacaatatcgccctgcaa	CRISPR spacer
tcccattcctcaacaacaatatcattttcact	Protospacer
******** .*************....*

78. spacer 3.1|3087175|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

atcttcatattgcgtgacgctgccgatgaacg	CRISPR spacer
tgccggatatggcgtgacgatgccgatgatgt	Protospacer
  *.  **** ******** *********

79. spacer 3.4|3087358|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

tgcccgttctgcctcttcgcactctcgatcaa	CRISPR spacer
tgcccgttctgtctcttggcactgccaccttc	Protospacer
***********.***** ***** .*. ..

80. spacer 3.12|3087847|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688 

gtggtggcctcaaataaattcgagcgctggag	CRISPR spacer
aaacttgcctcaaataaattcgcgcggtgttc	Protospacer
. . * **************** *** **

81. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******

82. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 10, identity: 0.688 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******

83. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******

84. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 10, identity: 0.688 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******

85. spacer 3.17|3088152|32|LS997973|CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 10, identity: 0.688 

gagtccgggggttatatagttatttaatgagc	CRISPR spacer
ttttttgggggttatacagttaattaatgctg	Protospacer
   *..**********.***** ******

86. spacer 3.27|3087724|33|LS997973|PILER-CR matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 10, identity: 0.697 

cggtaaagccacaccattttttattgacctcgc	CRISPR spacer
ttctgaaaccacaccattttttgttgaccctaa	Protospacer
.  *.**.**************.******...

87. spacer 3.27|3087724|33|LS997973|PILER-CR matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 10, identity: 0.697 

cggtaaagccacaccattttttattgacctcgc	CRISPR spacer
ttctgaaaccacaccattttttgttgaccctaa	Protospacer
.  *.**.**************.******...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage