Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR026983 Christensenella sp. Marseille-P3954 genome assembly, chromosome: contig00001 9 crisprs NA 1 5 0 0

Results visualization

1. LR026983
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_1 315184-315343 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_2 321535-321905 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_3 439723-440005 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_4 537591-537687 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_5 777755-777844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_6 1205003-1205906 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_7 1422287-1422513 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_8 2166674-2166810 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR026983_9 2191941-2193042 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR026983_4 4.1|537623|33|LR026983|CRISPRCasFinder 537623-537655 33 LR026983.1 1212639-1212671 0 1.0

1. spacer 4.1|537623|33|LR026983|CRISPRCasFinder matches to position: 1212639-1212671, mismatch: 0, identity: 1.0 

gacgatccacggggtgtcccttgacgtaaaact	CRISPR spacer
gacgatccacggggtgtcccttgacgtaaaact	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR026983_2 2.2|321637|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 321637-321670 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2029297-2029330 6 0.824
LR026983_9 9.1|2191973|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 2191973-2192006 34 CP031286 Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence 660-693 8 0.765
LR026983_9 9.1|2191973|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 2191973-2192006 34 NZ_CP040808 Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence 2820-2853 8 0.765
LR026983_6 6.10|1205638|35|LR026983|CRISPRCasFinder,CRT,PILER-CR 1205638-1205672 35 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 74185-74219 9 0.743
LR026983_9 9.4|2192173|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 2192173-2192206 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 608392-608425 10 0.706
LR026983_9 9.4|2192173|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 2192173-2192206 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1205139-1205172 10 0.706
LR026983_2 2.5|321839|34|LR026983|PILER-CR,CRISPRCasFinder,CRT 321839-321872 34 CP054928 Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence 48037-48070 11 0.676

1. spacer 2.2|321637|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.824 

acgcaagcgcaattactaccggaat-cctcacagc	CRISPR spacer
tcgcaggcgcaataactaccggaatgccgcagag-	Protospacer
 ****.******* *********** ** ** **

2. spacer 9.1|2191973|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to CP031286 (Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence) position: , mismatch: 8, identity: 0.765 

-actgataatcaacaaacgaggtgacaacaatgtc	CRISPR spacer
tgctgg-gatcagcaaacgaggtgacaaaaatttg	Protospacer
 .***. .****.*************** *** *

3. spacer 9.1|2191973|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040808 (Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence) position: , mismatch: 8, identity: 0.765 

actgataatcaacaaacgaggtgacaacaatgtc	CRISPR spacer
gctggggatcagcaaacgaggtgacaaaaatttg	Protospacer
.***. .****.*************** *** *

4. spacer 6.10|1205638|35|LR026983|CRISPRCasFinder,CRT,PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.743 

gcgctggaaacgacggtggcggaaggccgcgcgtc	CRISPR spacer
tcgctggaagcgacggtggcggacggacttgggcg	Protospacer
 ********.************* ** * .* *.

5. spacer 9.4|2192173|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.706 

gaccatatccgcaagcggtggagcgtgtggcagg	CRISPR spacer
aggatgatgcgcaagcggtggagcgtgggggcgg	Protospacer
..    ** ****************** **  **

6. spacer 9.4|2192173|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.706 

gaccatatccgcaagcggtggagcgtgtggcagg	CRISPR spacer
aggatgatgcgcaagcggtggagcgtgggggcgg	Protospacer
..    ** ****************** **  **

7. spacer 2.5|321839|34|LR026983|PILER-CR,CRISPRCasFinder,CRT matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676 

gcccgctcgatcaactgctctctgacgatgcggt	CRISPR spacer
gccggcacgatcaactgctctctggtagctcaac	Protospacer
*** ** *****************..... *...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage