Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027382 Alistipes sp. Marseille-P5997 genome assembly, chromosome: contig00001 6 crisprs NA 0 2 0 0

Results visualization

1. LR027382
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_1 73-190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_2 1074763-1074863 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_3 1506830-1507117 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_4 2456098-2456190 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_5 2793728-2793819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027382_6 3191529-3191619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027382_3 3.3|1507000|27|LR027382|PILER-CR 1507000-1507026 27 MN693674 Marine virus AFVG_250M120, complete genome 372-398 6 0.778
LR027382_3 3.4|1507063|27|LR027382|PILER-CR 1507063-1507089 27 NZ_LR723669 Rhizobium sp. Khangiran2 plasmid 2 7997-8023 6 0.778

1. spacer 3.3|1507000|27|LR027382|PILER-CR matches to MN693674 (Marine virus AFVG_250M120, complete genome) position: , mismatch: 6, identity: 0.778 

ttgaaacacacaaaatacctcagctct	CRISPR spacer
acataacacacaaaatacctaagccct	Protospacer
 .. **************** ***.**

2. spacer 3.4|1507063|27|LR027382|PILER-CR matches to NZ_LR723669 (Rhizobium sp. Khangiran2 plasmid 2) position: , mismatch: 6, identity: 0.778 

gaggaacatcccaaatccgtcagcgcc	CRISPR spacer
catcgacatccccaatccgtcagcgca	Protospacer
 *  .******* *************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage