Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027876 Staphylococcus aureus strain JKD6009 genome assembly, chromosome: 1 11 crisprs NA 7 1 0 0

Results visualization

1. LR027876
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_1 419539-419639 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_2 687252-687344 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_3 802997-803079 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_4 850877-850962 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_5 900716-900797 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_6 1101153-1101240 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_7 1185440-1185525 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_8 1959270-1959397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_9 2300337-2300487 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_10 2425820-2426013 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027876_11 2923729-2923812 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027876_5 5.1|900740|34|LR027876|CRISPRCasFinder 900740-900773 34 LR027876.1 1396065-1396098 0 1.0
LR027876_5 5.1|900740|34|LR027876|CRISPRCasFinder 900740-900773 34 LR027876.1 1487914-1487947 0 1.0
LR027876_10 10.2|2425899|36|LR027876|CRT 2425899-2425934 36 LR027876.1 1185371-1185406 0 1.0
LR027876_7 7.1|1185470|26|LR027876|CRISPRCasFinder 1185470-1185495 26 LR027876.1 287087-287112 1 0.962
LR027876_7 7.1|1185470|26|LR027876|CRISPRCasFinder 1185470-1185495 26 LR027876.1 812568-812593 1 0.962
LR027876_10 10.2|2425899|36|LR027876|CRT 2425899-2425934 36 LR027876.1 1854338-1854373 1 0.972
LR027876_11 11.1|2923755|32|LR027876|CRISPRCasFinder 2923755-2923786 32 LR027876.1 851043-851074 1 0.969
LR027876_11 11.1|2923755|32|LR027876|CRISPRCasFinder 2923755-2923786 32 LR027876.1 1111113-1111144 1 0.969
LR027876_11 11.1|2923755|32|LR027876|CRISPRCasFinder 2923755-2923786 32 LR027876.1 1488004-1488035 1 0.969
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 LR027876.1 287087-287112 2 0.923
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 LR027876.1 812568-812593 2 0.923
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 LR027876.1 964849-964874 2 0.923
LR027876_7 7.1|1185470|26|LR027876|CRISPRCasFinder 1185470-1185495 26 LR027876.1 812624-812649 2 0.923
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 850943-850975 2 0.939
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 1185427-1185459 2 0.939
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 1396020-1396052 2 0.939
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 1487960-1487992 2 0.939
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 2036852-2036884 2 0.939
LR027876_10 10.1|2425843|33|LR027876|CRT 2425843-2425875 33 LR027876.1 2701243-2701275 2 0.939
LR027876_10 10.2|2425899|36|LR027876|CRT 2425899-2425934 36 LR027876.1 287212-287247 2 0.944
LR027876_10 10.2|2425899|36|LR027876|CRT 2425899-2425934 36 LR027876.1 1667019-1667054 2 0.944
LR027876_10 10.2|2425899|36|LR027876|CRT 2425899-2425934 36 LR027876.1 2047596-2047631 2 0.944
LR027876_10 10.3|2425958|33|LR027876|CRT 2425958-2425990 33 LR027876.1 850943-850975 2 0.939
LR027876_10 10.3|2425958|33|LR027876|CRT 2425958-2425990 33 LR027876.1 1185427-1185459 2 0.939
LR027876_10 10.3|2425958|33|LR027876|CRT 2425958-2425990 33 LR027876.1 1396020-1396052 2 0.939
LR027876_10 10.3|2425958|33|LR027876|CRT 2425958-2425990 33 LR027876.1 2036852-2036884 2 0.939
LR027876_10 10.3|2425958|33|LR027876|CRT 2425958-2425990 33 LR027876.1 2701243-2701275 2 0.939

1. spacer 5.1|900740|34|LR027876|CRISPRCasFinder matches to position: 1396065-1396098, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|900740|34|LR027876|CRISPRCasFinder matches to position: 1487914-1487947, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 10.2|2425899|36|LR027876|CRT matches to position: 1185371-1185406, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 7.1|1185470|26|LR027876|CRISPRCasFinder matches to position: 287087-287112, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cgggcccccaacatagaagctggcgg	Protospacer
**** *********************

5. spacer 7.1|1185470|26|LR027876|CRISPRCasFinder matches to position: 812568-812593, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
******************** *****

6. spacer 10.2|2425899|36|LR027876|CRT matches to position: 1854338-1854373, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

7. spacer 11.1|2923755|32|LR027876|CRISPRCasFinder matches to position: 851043-851074, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

8. spacer 11.1|2923755|32|LR027876|CRISPRCasFinder matches to position: 1111113-1111144, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

9. spacer 11.1|2923755|32|LR027876|CRISPRCasFinder matches to position: 1488004-1488035, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

10. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to position: 287087-287112, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttgggggcccg	Protospacer
************.******** ****

11. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to position: 812568-812593, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

12. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to position: 964849-964874, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

13. spacer 7.1|1185470|26|LR027876|CRISPRCasFinder matches to position: 812624-812649, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacataaaagcaggcgg	Protospacer
***************.**** *****

14. spacer 10.1|2425843|33|LR027876|CRT matches to position: 850943-850975, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

15. spacer 10.1|2425843|33|LR027876|CRT matches to position: 1185427-1185459, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

16. spacer 10.1|2425843|33|LR027876|CRT matches to position: 1396020-1396052, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 10.1|2425843|33|LR027876|CRT matches to position: 1487960-1487992, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

18. spacer 10.1|2425843|33|LR027876|CRT matches to position: 2036852-2036884, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

19. spacer 10.1|2425843|33|LR027876|CRT matches to position: 2701243-2701275, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

20. spacer 10.2|2425899|36|LR027876|CRT matches to position: 287212-287247, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

21. spacer 10.2|2425899|36|LR027876|CRT matches to position: 1667019-1667054, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

22. spacer 10.2|2425899|36|LR027876|CRT matches to position: 2047596-2047631, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

23. spacer 10.3|2425958|33|LR027876|CRT matches to position: 850943-850975, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

24. spacer 10.3|2425958|33|LR027876|CRT matches to position: 1185427-1185459, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 10.3|2425958|33|LR027876|CRT matches to position: 1396020-1396052, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

26. spacer 10.3|2425958|33|LR027876|CRT matches to position: 2036852-2036884, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

27. spacer 10.3|2425958|33|LR027876|CRT matches to position: 2701243-2701275, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
LR027876_4 4.1|850907|26|LR027876|CRISPRCasFinder 850907-850932 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808

1. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

2. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

3. spacer 4.1|850907|26|LR027876|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage