Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027873 Staphylococcus aureus strain BPH2070 genome assembly, chromosome: 1 11 crisprs NA 7 1 0 0

Results visualization

1. LR027873
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_1 429488-429588 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_2 692081-692173 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_3 833534-833616 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_4 880083-880168 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_5 929981-930062 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_6 1131750-1131837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_7 1216264-1216349 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_8 2172789-2172877 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_9 2299799-2299949 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_10 2425295-2425488 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027873_11 2923478-2923561 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027873_5 5.1|930005|34|LR027873|CRISPRCasFinder 930005-930038 34 LR027873.1 1429748-1429781 0 1.0
LR027873_5 5.1|930005|34|LR027873|CRISPRCasFinder 930005-930038 34 LR027873.1 1521597-1521630 0 1.0
LR027873_10 10.2|2425374|36|LR027873|CRT 2425374-2425409 36 LR027873.1 1216195-1216230 0 1.0
LR027873_7 7.1|1216294|26|LR027873|CRISPRCasFinder 1216294-1216319 26 LR027873.1 313619-313644 1 0.962
LR027873_7 7.1|1216294|26|LR027873|CRISPRCasFinder 1216294-1216319 26 LR027873.1 843105-843130 1 0.962
LR027873_10 10.2|2425374|36|LR027873|CRT 2425374-2425409 36 LR027873.1 1890409-1890444 1 0.972
LR027873_11 11.1|2923504|32|LR027873|CRISPRCasFinder 2923504-2923535 32 LR027873.1 880249-880280 1 0.969
LR027873_11 11.1|2923504|32|LR027873|CRISPRCasFinder 2923504-2923535 32 LR027873.1 880307-880338 1 0.969
LR027873_11 11.1|2923504|32|LR027873|CRISPRCasFinder 2923504-2923535 32 LR027873.1 1141710-1141741 1 0.969
LR027873_11 11.1|2923504|32|LR027873|CRISPRCasFinder 2923504-2923535 32 LR027873.1 1521687-1521718 1 0.969
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 LR027873.1 313619-313644 2 0.923
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 LR027873.1 843105-843130 2 0.923
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 LR027873.1 995445-995470 2 0.923
LR027873_7 7.1|1216294|26|LR027873|CRISPRCasFinder 1216294-1216319 26 LR027873.1 843161-843186 2 0.923
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 880149-880181 2 0.939
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 1216251-1216283 2 0.939
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 1429703-1429735 2 0.939
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 1521643-1521675 2 0.939
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 2092685-2092717 2 0.939
LR027873_10 10.1|2425318|33|LR027873|CRT 2425318-2425350 33 LR027873.1 2699396-2699428 2 0.939
LR027873_10 10.2|2425374|36|LR027873|CRT 2425374-2425409 36 LR027873.1 313744-313779 2 0.944
LR027873_10 10.2|2425374|36|LR027873|CRT 2425374-2425409 36 LR027873.1 1701755-1701790 2 0.944
LR027873_10 10.2|2425374|36|LR027873|CRT 2425374-2425409 36 LR027873.1 2103399-2103434 2 0.944
LR027873_10 10.3|2425433|33|LR027873|CRT 2425433-2425465 33 LR027873.1 880149-880181 2 0.939
LR027873_10 10.3|2425433|33|LR027873|CRT 2425433-2425465 33 LR027873.1 1216251-1216283 2 0.939
LR027873_10 10.3|2425433|33|LR027873|CRT 2425433-2425465 33 LR027873.1 1429703-1429735 2 0.939
LR027873_10 10.3|2425433|33|LR027873|CRT 2425433-2425465 33 LR027873.1 2092685-2092717 2 0.939
LR027873_10 10.3|2425433|33|LR027873|CRT 2425433-2425465 33 LR027873.1 2699396-2699428 2 0.939

1. spacer 5.1|930005|34|LR027873|CRISPRCasFinder matches to position: 1429748-1429781, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|930005|34|LR027873|CRISPRCasFinder matches to position: 1521597-1521630, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 10.2|2425374|36|LR027873|CRT matches to position: 1216195-1216230, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 7.1|1216294|26|LR027873|CRISPRCasFinder matches to position: 313619-313644, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cgggcccccaacatagaagctggcgg	Protospacer
**** *********************

5. spacer 7.1|1216294|26|LR027873|CRISPRCasFinder matches to position: 843105-843130, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
******************** *****

6. spacer 10.2|2425374|36|LR027873|CRT matches to position: 1890409-1890444, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

7. spacer 11.1|2923504|32|LR027873|CRISPRCasFinder matches to position: 880249-880280, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

8. spacer 11.1|2923504|32|LR027873|CRISPRCasFinder matches to position: 880307-880338, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

9. spacer 11.1|2923504|32|LR027873|CRISPRCasFinder matches to position: 1141710-1141741, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

10. spacer 11.1|2923504|32|LR027873|CRISPRCasFinder matches to position: 1521687-1521718, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

11. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to position: 313619-313644, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttgggggcccg	Protospacer
************.******** ****

12. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to position: 843105-843130, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

13. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to position: 995445-995470, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

14. spacer 7.1|1216294|26|LR027873|CRISPRCasFinder matches to position: 843161-843186, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacataaaagcaggcgg	Protospacer
***************.**** *****

15. spacer 10.1|2425318|33|LR027873|CRT matches to position: 880149-880181, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

16. spacer 10.1|2425318|33|LR027873|CRT matches to position: 1216251-1216283, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 10.1|2425318|33|LR027873|CRT matches to position: 1429703-1429735, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

18. spacer 10.1|2425318|33|LR027873|CRT matches to position: 1521643-1521675, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

19. spacer 10.1|2425318|33|LR027873|CRT matches to position: 2092685-2092717, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

20. spacer 10.1|2425318|33|LR027873|CRT matches to position: 2699396-2699428, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

21. spacer 10.2|2425374|36|LR027873|CRT matches to position: 313744-313779, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

22. spacer 10.2|2425374|36|LR027873|CRT matches to position: 1701755-1701790, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

23. spacer 10.2|2425374|36|LR027873|CRT matches to position: 2103399-2103434, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

24. spacer 10.3|2425433|33|LR027873|CRT matches to position: 880149-880181, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 10.3|2425433|33|LR027873|CRT matches to position: 1216251-1216283, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

26. spacer 10.3|2425433|33|LR027873|CRT matches to position: 1429703-1429735, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

27. spacer 10.3|2425433|33|LR027873|CRT matches to position: 2092685-2092717, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

28. spacer 10.3|2425433|33|LR027873|CRT matches to position: 2699396-2699428, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
LR027873_4 4.1|880113|26|LR027873|CRISPRCasFinder 880113-880138 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808

1. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

2. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

3. spacer 4.1|880113|26|LR027873|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage