Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027877 Staphylococcus aureus isolate BPH3244 genome assembly, chromosome: 1 10 crisprs NA 7 1 0 0

Results visualization

1. LR027877
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_1 405829-405929 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_2 672476-672568 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_3 788359-788441 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_4 834907-834992 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_5 901495-901576 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_6 1101969-1102056 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_7 1187815-1187900 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_8 2284226-2284376 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_9 2431766-2431959 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027877_10 2929474-2929557 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027877_5 5.1|901519|34|LR027877|CRISPRCasFinder 901519-901552 34 LR027877.1 1249350-1249383 0 1.0
LR027877_5 5.1|901519|34|LR027877|CRISPRCasFinder 901519-901552 34 LR027877.1 1339867-1339900 0 1.0
LR027877_9 9.2|2431845|36|LR027877|CRT 2431845-2431880 36 LR027877.1 1187746-1187781 0 1.0
LR027877_7 7.1|1187845|26|LR027877|CRISPRCasFinder 1187845-1187870 26 LR027877.1 288950-288975 1 0.962
LR027877_7 7.1|1187845|26|LR027877|CRISPRCasFinder 1187845-1187870 26 LR027877.1 797930-797955 1 0.962
LR027877_9 9.2|2431845|36|LR027877|CRT 2431845-2431880 36 LR027877.1 1847543-1847578 1 0.972
LR027877_10 10.1|2929500|32|LR027877|CRISPRCasFinder 2929500-2929531 32 LR027877.1 835073-835104 1 0.969
LR027877_10 10.1|2929500|32|LR027877|CRISPRCasFinder 2929500-2929531 32 LR027877.1 835131-835162 1 0.969
LR027877_10 10.1|2929500|32|LR027877|CRISPRCasFinder 2929500-2929531 32 LR027877.1 1111929-1111960 1 0.969
LR027877_10 10.1|2929500|32|LR027877|CRISPRCasFinder 2929500-2929531 32 LR027877.1 1249262-1249293 1 0.969
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 LR027877.1 288950-288975 2 0.923
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 LR027877.1 797930-797955 2 0.923
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 LR027877.1 965666-965691 2 0.923
LR027877_7 7.1|1187845|26|LR027877|CRISPRCasFinder 1187845-1187870 26 LR027877.1 797986-798011 2 0.923
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 834973-835005 2 0.939
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 1187802-1187834 2 0.939
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 1249305-1249337 2 0.939
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 1339913-1339945 2 0.939
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 2048271-2048303 2 0.939
LR027877_9 9.1|2431789|33|LR027877|CRT 2431789-2431821 33 LR027877.1 2705398-2705430 2 0.939
LR027877_9 9.2|2431845|36|LR027877|CRT 2431845-2431880 36 LR027877.1 289075-289110 2 0.944
LR027877_9 9.2|2431845|36|LR027877|CRT 2431845-2431880 36 LR027877.1 1657558-1657593 2 0.944
LR027877_9 9.2|2431845|36|LR027877|CRT 2431845-2431880 36 LR027877.1 2058985-2059020 2 0.944
LR027877_9 9.3|2431904|33|LR027877|CRT 2431904-2431936 33 LR027877.1 834973-835005 2 0.939
LR027877_9 9.3|2431904|33|LR027877|CRT 2431904-2431936 33 LR027877.1 1187802-1187834 2 0.939
LR027877_9 9.3|2431904|33|LR027877|CRT 2431904-2431936 33 LR027877.1 1339913-1339945 2 0.939
LR027877_9 9.3|2431904|33|LR027877|CRT 2431904-2431936 33 LR027877.1 2048271-2048303 2 0.939
LR027877_9 9.3|2431904|33|LR027877|CRT 2431904-2431936 33 LR027877.1 2705398-2705430 2 0.939

1. spacer 5.1|901519|34|LR027877|CRISPRCasFinder matches to position: 1249350-1249383, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 5.1|901519|34|LR027877|CRISPRCasFinder matches to position: 1339867-1339900, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 9.2|2431845|36|LR027877|CRT matches to position: 1187746-1187781, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 7.1|1187845|26|LR027877|CRISPRCasFinder matches to position: 288950-288975, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cgggcccccaacatagaagctggcgg	Protospacer
**** *********************

5. spacer 7.1|1187845|26|LR027877|CRISPRCasFinder matches to position: 797930-797955, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
******************** *****

6. spacer 9.2|2431845|36|LR027877|CRT matches to position: 1847543-1847578, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

7. spacer 10.1|2929500|32|LR027877|CRISPRCasFinder matches to position: 835073-835104, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

8. spacer 10.1|2929500|32|LR027877|CRISPRCasFinder matches to position: 835131-835162, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

9. spacer 10.1|2929500|32|LR027877|CRISPRCasFinder matches to position: 1111929-1111960, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

10. spacer 10.1|2929500|32|LR027877|CRISPRCasFinder matches to position: 1249262-1249293, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

11. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to position: 288950-288975, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttgggggcccg	Protospacer
************.******** ****

12. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to position: 797930-797955, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

13. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to position: 965666-965691, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

14. spacer 7.1|1187845|26|LR027877|CRISPRCasFinder matches to position: 797986-798011, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacataaaagcaggcgg	Protospacer
***************.**** *****

15. spacer 9.1|2431789|33|LR027877|CRT matches to position: 834973-835005, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

16. spacer 9.1|2431789|33|LR027877|CRT matches to position: 1187802-1187834, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

17. spacer 9.1|2431789|33|LR027877|CRT matches to position: 1249305-1249337, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

18. spacer 9.1|2431789|33|LR027877|CRT matches to position: 1339913-1339945, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

19. spacer 9.1|2431789|33|LR027877|CRT matches to position: 2048271-2048303, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

20. spacer 9.1|2431789|33|LR027877|CRT matches to position: 2705398-2705430, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

21. spacer 9.2|2431845|36|LR027877|CRT matches to position: 289075-289110, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

22. spacer 9.2|2431845|36|LR027877|CRT matches to position: 1657558-1657593, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

23. spacer 9.2|2431845|36|LR027877|CRT matches to position: 2058985-2059020, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

24. spacer 9.3|2431904|33|LR027877|CRT matches to position: 834973-835005, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

25. spacer 9.3|2431904|33|LR027877|CRT matches to position: 1187802-1187834, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

26. spacer 9.3|2431904|33|LR027877|CRT matches to position: 1339913-1339945, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

27. spacer 9.3|2431904|33|LR027877|CRT matches to position: 2048271-2048303, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

28. spacer 9.3|2431904|33|LR027877|CRT matches to position: 2705398-2705430, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
LR027877_4 4.1|834937|26|LR027877|CRISPRCasFinder 834937-834962 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808

1. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

2. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

3. spacer 4.1|834937|26|LR027877|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage