Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR027869 Staphylococcus aureus isolate BPH2869 genome assembly, chromosome: 1 11 crisprs NA 8 2 0 0

Results visualization

1. LR027869
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_1 420881-420981 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_2 686740-686832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_3 802554-802636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_4 844981-845061 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_5 850379-850460 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_6 916204-916285 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_7 1103408-1103495 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_8 1187696-1187781 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_9 2308931-2309081 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_10 2434424-2434617 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR027869_11 2973502-2973585 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR027869_6 6.1|916228|34|LR027869|CRISPRCasFinder 916228-916261 34 LR027869.1 1399853-1399886 0 1.0
LR027869_6 6.1|916228|34|LR027869|CRISPRCasFinder 916228-916261 34 LR027869.1 1491570-1491603 0 1.0
LR027869_10 10.2|2434503|36|LR027869|CRT 2434503-2434538 36 LR027869.1 1187627-1187662 0 1.0
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 367639-367667 1 0.966
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 1859336-1859364 1 0.966
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 LR027869.1 965885-965914 1 0.967
LR027869_8 8.1|1187726|26|LR027869|CRISPRCasFinder 1187726-1187751 26 LR027869.1 287085-287110 1 0.962
LR027869_8 8.1|1187726|26|LR027869|CRISPRCasFinder 1187726-1187751 26 LR027869.1 812125-812150 1 0.962
LR027869_10 10.2|2434503|36|LR027869|CRT 2434503-2434538 36 LR027869.1 1859329-1859364 1 0.972
LR027869_11 11.1|2973528|32|LR027869|CRISPRCasFinder 2973528-2973559 32 LR027869.1 850545-850576 1 0.969
LR027869_11 11.1|2973528|32|LR027869|CRISPRCasFinder 2973528-2973559 32 LR027869.1 1113368-1113399 1 0.969
LR027869_11 11.1|2973528|32|LR027869|CRISPRCasFinder 2973528-2973559 32 LR027869.1 1491660-1491691 1 0.969
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 287217-287245 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 812090-812118 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 916270-916298 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 985410-985438 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 1187634-1187662 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 1672007-1672035 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 2062037-2062065 2 0.931
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 LR027869.1 2627353-2627381 2 0.931
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 LR027869.1 812125-812154 2 0.933
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 LR027869.1 965771-965800 2 0.933
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 LR027869.1 2051309-2051338 2 0.933
LR027869_8 8.1|1187726|26|LR027869|CRISPRCasFinder 1187726-1187751 26 LR027869.1 812181-812206 2 0.923
LR027869_10 10.1|2434447|33|LR027869|CRT 2434447-2434479 33 LR027869.1 1187683-1187715 2 0.939
LR027869_10 10.1|2434447|33|LR027869|CRT 2434447-2434479 33 LR027869.1 1399808-1399840 2 0.939
LR027869_10 10.1|2434447|33|LR027869|CRT 2434447-2434479 33 LR027869.1 1491616-1491648 2 0.939
LR027869_10 10.1|2434447|33|LR027869|CRT 2434447-2434479 33 LR027869.1 2051293-2051325 2 0.939
LR027869_10 10.1|2434447|33|LR027869|CRT 2434447-2434479 33 LR027869.1 2750727-2750759 2 0.939
LR027869_10 10.2|2434503|36|LR027869|CRT 2434503-2434538 36 LR027869.1 287210-287245 2 0.944
LR027869_10 10.2|2434503|36|LR027869|CRT 2434503-2434538 36 LR027869.1 1672007-1672042 2 0.944
LR027869_10 10.2|2434503|36|LR027869|CRT 2434503-2434538 36 LR027869.1 2062037-2062072 2 0.944
LR027869_10 10.3|2434562|33|LR027869|CRT 2434562-2434594 33 LR027869.1 1187683-1187715 2 0.939
LR027869_10 10.3|2434562|33|LR027869|CRT 2434562-2434594 33 LR027869.1 1399808-1399840 2 0.939
LR027869_10 10.3|2434562|33|LR027869|CRT 2434562-2434594 33 LR027869.1 2051293-2051325 2 0.939
LR027869_10 10.3|2434562|33|LR027869|CRT 2434562-2434594 33 LR027869.1 2750727-2750759 2 0.939

1. spacer 6.1|916228|34|LR027869|CRISPRCasFinder matches to position: 1399853-1399886, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 6.1|916228|34|LR027869|CRISPRCasFinder matches to position: 1491570-1491603, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 10.2|2434503|36|LR027869|CRT matches to position: 1187627-1187662, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 367639-367667, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcttgtagaatttcttttcgaaa	Protospacer
*******.*********************

5. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 1859336-1859364, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaa	Protospacer
********.********************

6. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to position: 965885-965914, mismatch: 1, identity: 0.967

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
cttttcgccagcttctgtgttggggccccg	Protospacer
****.*************************

7. spacer 8.1|1187726|26|LR027869|CRISPRCasFinder matches to position: 287085-287110, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cgggcccccaacatagaagctggcgg	Protospacer
**** *********************

8. spacer 8.1|1187726|26|LR027869|CRISPRCasFinder matches to position: 812125-812150, mismatch: 1, identity: 0.962

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
******************** *****

9. spacer 10.2|2434503|36|LR027869|CRT matches to position: 1859329-1859364, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

10. spacer 11.1|2973528|32|LR027869|CRISPRCasFinder matches to position: 850545-850576, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

11. spacer 11.1|2973528|32|LR027869|CRISPRCasFinder matches to position: 1113368-1113399, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

12. spacer 11.1|2973528|32|LR027869|CRISPRCasFinder matches to position: 1491660-1491691, mismatch: 1, identity: 0.969

acaccctaactcgcattgcctgtagaatttct	CRISPR spacer
acaccccaactcgcattgcctgtagaatttct	Protospacer
******.*************************

13. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 287217-287245, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

14. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 812090-812118, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

15. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 916270-916298, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

16. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 985410-985438, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

17. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 1187634-1187662, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttctttttgaaa	Protospacer
********.***************.****

18. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 1672007-1672035, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

19. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 2062037-2062065, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaa	Protospacer
********.***********.********

20. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to position: 2627353-2627381, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

21. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to position: 812125-812154, mismatch: 2, identity: 0.933

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
ctttccgcctgcttctatgttggggccccg	Protospacer
********* ******.*************

22. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to position: 965771-965800, mismatch: 2, identity: 0.933

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
ctttccaccagcctctgtgttggggccccg	Protospacer
******.*****.*****************

23. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to position: 2051309-2051338, mismatch: 2, identity: 0.933

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
cttttcgtcagcttctgtgttggggccccg	Protospacer
****.**.**********************

24. spacer 8.1|1187726|26|LR027869|CRISPRCasFinder matches to position: 812181-812206, mismatch: 2, identity: 0.923

cggggccccaacatagaagctggcgg	CRISPR spacer
cggggccccaacataaaagcaggcgg	Protospacer
***************.**** *****

25. spacer 10.1|2434447|33|LR027869|CRT matches to position: 1187683-1187715, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

26. spacer 10.1|2434447|33|LR027869|CRT matches to position: 1399808-1399840, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 10.1|2434447|33|LR027869|CRT matches to position: 1491616-1491648, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

28. spacer 10.1|2434447|33|LR027869|CRT matches to position: 2051293-2051325, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

29. spacer 10.1|2434447|33|LR027869|CRT matches to position: 2750727-2750759, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

30. spacer 10.2|2434503|36|LR027869|CRT matches to position: 287210-287245, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

31. spacer 10.2|2434503|36|LR027869|CRT matches to position: 1672007-1672042, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

32. spacer 10.2|2434503|36|LR027869|CRT matches to position: 2062037-2062072, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

33. spacer 10.3|2434562|33|LR027869|CRT matches to position: 1187683-1187715, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

34. spacer 10.3|2434562|33|LR027869|CRT matches to position: 1399808-1399840, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

35. spacer 10.3|2434562|33|LR027869|CRT matches to position: 2051293-2051325, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

36. spacer 10.3|2434562|33|LR027869|CRT matches to position: 2750727-2750759, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR027869_4 4.1|845007|29|LR027869|CRISPRCasFinder 845007-845035 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333731-333760 7 0.767
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715507-715536 7 0.767
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 NZ_CP017942 Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence 343057-343086 7 0.767
LR027869_5 5.1|850405|30|LR027869|CRISPRCasFinder 850405-850434 30 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3355-3384 8 0.733

1. spacer 4.1|845007|29|LR027869|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtaggatttcttctaagtg	Protospacer
**************.*******.* .. .

2. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
ctggacgccagcttctgtgttgaggcctta	Protospacer
**   *****************.****...

3. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
atctccgccagcttctgtgtttggccctga	Protospacer
 *.****************** ** **. .

4. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to NZ_CP017942 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
ctttccgccagcgtctgtgatggcgtagtg	Protospacer
************ ****** *** *.  .*

5. spacer 5.1|850405|30|LR027869|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

ctttccgccagcttctgtgttggggccccg	CRISPR spacer
atgaccgccagcttctgtgtctgggcctac	Protospacer
 *  ****************. *****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage