1. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
2. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
3. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
4. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
5. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
6. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
7. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
8. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
9. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
10. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
11. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
12. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
13. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
14. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
15. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
16. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
17. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
18. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
19. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
20. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
21. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
22. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
23. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
24. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc Protospacer
********************************
25. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY020154 (Klebsiella pneumoniae strain Kpn-431cz plasmid pKpn-431cz, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
26. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY270851 (Citrobacter freundii strain 112298 plasmid p112298-catA, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
27. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
28. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
29. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
30. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
31. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
32. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
33. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
34. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
35. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
36. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
37. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
38. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
39. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
40. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
41. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
42. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
43. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
44. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
45. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
46. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
47. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
48. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
49. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
50. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
51. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
52. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
53. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
54. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
55. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
56. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
57. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
58. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
59. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
60. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
61. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
62. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
63. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
64. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
65. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
66. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
67. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
68. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
69. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
70. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
71. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
72. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
73. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
74. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggctgg Protospacer
********************************
75. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
76. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
77. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
78. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
79. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
80. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
81. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
82. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
83. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
84. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
85. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
86. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
87. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
88. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
89. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
90. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
91. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
92. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
93. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
94. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
95. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
96. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
97. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
98. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
99. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
100. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
101. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
102. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
103. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
104. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MH114596 (Salmonella enterica strain 13-1681 plasmid p131681, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
105. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
106. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
107. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
108. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
109. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
110. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
111. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
112. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
113. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
114. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
115. spacer 4.7|3812270|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 1, identity: 0.969
ttttgctgacaccggcaatactgaacggctgg CRISPR spacer
ttttgctgacaccggcaatactgaacggttgg Protospacer
****************************.***
116. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc Protospacer
******************* ********.***
117. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc Protospacer
******************* ********.***
118. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc Protospacer
********* *****.****************
119. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc Protospacer
********* *****.****************
120. spacer 4.1|3811907|32|LR130532|CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938
acatgaatgtcggttcagaccgtgtttttacc CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc Protospacer
***************** * ************
121. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to LN681534 (Clostridium phage phiCD24-1, complete genome) position: , mismatch: 5, identity: 0.833
ggaatgatatttcaataaataattataaca- CRISPR spacer
agaattatatttgaataaataatt-taatag Protospacer
.**** ****** *********** ***.*
122. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MN718463 (Clostridium phage phiCDKH01, complete genome) position: , mismatch: 5, identity: 0.833
ggaatgatatttcaataaataattataaca- CRISPR spacer
agaattatatttgaataaataatt-taatag Protospacer
.**** ****** *********** ***.*
123. spacer 4.9|3812392|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MN693292 (Marine virus AFVG_25M2, complete genome) position: , mismatch: 5, identity: 0.844
taaaccaccagccagaccaccaat--taccacac CRISPR spacer
taaaccaccagccaaaccaccgatactaccaa-- Protospacer
**************.******.** *****
124. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 6, identity: 0.8
ggaatgatatttcaataaataattataaca CRISPR spacer
tgaatgatatttcaataactgattatctcg Protospacer
***************** *.***** *.
125. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 6, identity: 0.8
ggaatgatatttcaataaataattataaca CRISPR spacer
tgaatgatatttcaataactgattatctcg Protospacer
***************** *.***** *.
126. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 6, identity: 0.8
ggaatgatatttcaataaataattataaca CRISPR spacer
ttaaaaatatttccataaaaaattataaca Protospacer
** .******* ***** **********
127. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 6, identity: 0.8
ggaatgatatttcaataaataattataaca CRISPR spacer
agaatgttatttaaataaataattgctaca Protospacer
.***** ***** ***********.. ***
128. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 6, identity: 0.8
ggaatgatatttcaataaataattataaca CRISPR spacer
ggatgattatttcaataattaattctaaca Protospacer
*** . *********** ***** *****
129. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
agagcgccggcggctcgccggatttgaccgc Protospacer
*****.***********.******* **
130. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
131. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
132. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
133. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
134. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg- CRISPR spacer
tgagcgacggcggcacgctggatgc-cgcgaa Protospacer
****** ******* ******** . ****.
135. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
136. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
137. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
138. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
139. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
140. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
141. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
142. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
143. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcaacgcgggcggctcgctggatgtgctcgg Protospacer
* *.**. *************** *** ***
144. spacer 4.16|3812029|32|LR130532|CRT matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 6, identity: 0.812
ggaatgatatttcaataaataattataacaat CRISPR spacer
ggatgattatttcaataattaattctaacaat Protospacer
*** . *********** ***** *******
145. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 6, identity: 0.812
-ggaatgatatttcaataaataattataacaat CRISPR spacer
tttaatga-atttctaaaaataattataacaaa Protospacer
***** ***** * ***************
146. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 7, identity: 0.767
ggaatgatatttcaataaataattataaca CRISPR spacer
atattgaaatttcaataaataattatcatt Protospacer
. * *** ****************** *.
147. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 7, identity: 0.767
ggaatgatatttcaataaataattataaca CRISPR spacer
atattgaaatttcaataaataattatcatt Protospacer
. * *** ****************** *.
148. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016590 (Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence) position: , mismatch: 7, identity: 0.767
ggaatgatatttcaataaataattataaca CRISPR spacer
acattgaaatttcaataaataattatcatt Protospacer
. * *** ****************** *.
149. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to KT895374 (Bacillus phage vB_BpuM-BpSp, complete genome) position: , mismatch: 7, identity: 0.767
ggaatgatatttcaataaataattataaca CRISPR spacer
tttaagataattcaatacataattataata Protospacer
* **** ******* **********.*
150. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009154 (Burkholderia pseudomallei strain TSV202 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774
tgagc---gtcggcggctcgctggatttgcgcgg CRISPR spacer
---gcttggtcggcggctcgctgaatgtgcgggc Protospacer
** ***************.** **** *
151. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP044019 (Acinetobacter indicus strain HY20 plasmid pAI01, complete sequence) position: , mismatch: 7, identity: 0.781
--ggaatgatatttcaataaataattataacaat CRISPR spacer
cagcattg--atttctatagataattataacaaa Protospacer
* * ** ***** ***.*************
152. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013516 (Streptobacillus moniliformis DSM 12112 plasmid pSMON01, complete sequence) position: , mismatch: 7, identity: 0.781
ggaatgat--atttcaataaataattataacaat CRISPR spacer
--atttatcaatttcaataaataattatgataaa Protospacer
* * ** ******************.*.**
153. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP027399 (Streptobacillus moniliformis strain FDAARGOS_310 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ggaatgat--atttcaataaataattataacaat CRISPR spacer
--atttatcaatttcaataaataattatgataaa Protospacer
* * ** ******************.*.**
154. spacer 4.16|3812029|32|LR130532|CRT matches to LN681534 (Clostridium phage phiCD24-1, complete genome) position: , mismatch: 7, identity: 0.781
ggaatgatatttcaataaataattataacaat- CRISPR spacer
agaattatatttgaataaataatt-taataggg Protospacer
.**** ****** *********** ***.*.
155. spacer 4.16|3812029|32|LR130532|CRT matches to MN718463 (Clostridium phage phiCDKH01, complete genome) position: , mismatch: 7, identity: 0.781
ggaatgatatttcaataaataattataacaat- CRISPR spacer
agaattatatttgaataaataatt-taataggg Protospacer
.**** ****** *********** ***.*.
156. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 8, identity: 0.733
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatgatatttaaaaaaataattaacgaa Protospacer
. ********** ** ********* . *
157. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 8, identity: 0.733
ggaatgatatttcaataaataattataaca CRISPR spacer
aaaaagatacttcaataaataattaagaac Protospacer
..** ****.*************** .*
158. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MG757166 (Gordonia phage SuperSulley, complete genome) position: , mismatch: 8, identity: 0.733
ggaatgatatttcaataaataattataaca CRISPR spacer
atgatgatatttgaatgaataattatgtga Protospacer
. .********* ***.*********. *
159. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MF919510 (Gordonia phage Kabluna, complete genome) position: , mismatch: 8, identity: 0.733
ggaatgatatttcaataaataattataaca CRISPR spacer
atgatgatatttgaatgaataattatgtga Protospacer
. .********* ***.*********. *
160. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MH779499 (Gordonia phage Buggaboo, complete genome) position: , mismatch: 8, identity: 0.733
ggaatgatatttcaataaataattataaca CRISPR spacer
atgatgatatttgaatgaataattatgtga Protospacer
. .********* ***.*********. *
161. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
gcctcaccggcggcacgctcgatttgcgcgg Protospacer
*..******* **** ***********
162. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.742
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag Protospacer
.* ********** ********.*** .*
163. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.742
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag Protospacer
.* ********** ********.*** .*
164. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.742
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag Protospacer
.* ********** ********.*** .*
165. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.742
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
cgctcgtcggcggcgcgctggatctgccgag Protospacer
.* ********** ********.*** .*
166. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038019 (Eikenella exigua strain PXX plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
gcctcatccaattcctgtgccaactcttggtg Protospacer
****** .***************** . *
167. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP037738 (Citrobacter freundii strain CAV1857 plasmid pCAV1857-47, complete sequence) position: , mismatch: 8, identity: 0.75
ggaatgatatttcaataaataattataacaat CRISPR spacer
tgaatgatatttcaataactgattatctcggg Protospacer
***************** *.***** *..
168. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_MF344556 (Enterobacter cloacae strain 30860 plasmid p30860-NR, complete sequence) position: , mismatch: 8, identity: 0.75
ggaatgatatttcaataaataattataacaat CRISPR spacer
tgaatgatatttcaataactgattatctcggg Protospacer
***************** *.***** *..
169. spacer 4.16|3812029|32|LR130532|CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 8, identity: 0.75
ggaatgatatttcaataaataattataacaat CRISPR spacer
ttaaaaatatttccataaaaaattataacata Protospacer
** .******* ***** **********
170. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 8, identity: 0.75
ggaatgatatttcaataaataattataacaat CRISPR spacer
agaatgttatttaaataaataattgctacaga Protospacer
.***** ***** ***********.. ***.
171. spacer 4.16|3812029|32|LR130532|CRT matches to MK318083 (Aeromonas phage Akh-2, complete genome) position: , mismatch: 8, identity: 0.75
ggaatgatatttcaataaataattataacaat CRISPR spacer
gaacggcgatttcaacaagtaattataacaac Protospacer
*.* * *******.**.************.
172. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030488 (Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
173. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP053186 (Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
174. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP053184 (Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
175. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030633 (Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
176. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
177. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
178. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030587 (Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
179. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030607 (Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
180. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030663 (Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
181. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030385 (Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
182. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014408 (Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
183. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014411 (Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
184. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014367 (Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
185. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP054441 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
186. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to LC383633 (Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
187. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP031889 (Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
188. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030513 (Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
189. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030666 (Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
190. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014386 (Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
191. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030397 (Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
192. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030414 (Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
193. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016862 (Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
194. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_010419 (Staphylococcus aureus plasmid pTZ2162, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
195. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030416 (Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
196. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030521 (Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
197. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030444 (Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
198. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014434 (Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
199. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_010077 (Staphylococcus aureus plasmid EDINA, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
200. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013289 (Staphylococcus aureus plasmid SAP015A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
201. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013294 (Staphylococcus aureus plasmid SAP046A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
202. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013298 (Staphylococcus aureus plasmid SAP050A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
203. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013299 (Staphylococcus aureus plasmid SAP051A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
204. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP035102 (Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
205. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030523 (Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
206. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_019148 (Staphylococcus aureus PM1 plasmid pPM1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
207. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030442 (Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
208. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030494 (Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
209. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP030324 (Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
210. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933272 (Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
211. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933273 (Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
212. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933274 (Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
213. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933275 (Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
214. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933276 (Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
215. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP017095 (Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
216. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_005127 (Staphylococcus aureus plasmid pUB101, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
217. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933268 (Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
218. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933269 (Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
219. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933270 (Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
220. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MK933271 (Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
221. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP012118 (Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
222. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030567 (Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
223. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030643 (Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
224. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030623 (Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
225. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013330 (Staphylococcus aureus plasmid pWBG759, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
226. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013332 (Staphylococcus aureus plasmid SAP052A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
227. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013348 (Staphylococcus aureus plasmid pSK156, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
228. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030463 (Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
229. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030697 (Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
230. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_023278 (Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
231. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP040802 (Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
232. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030446 (Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
233. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030536 (Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
234. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030539 (Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
235. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
236. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029079 (Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
237. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030700 (Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
238. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014394 (Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
239. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014414 (Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
240. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030672 (Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
241. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
242. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
attcaaatactttaataaataattataacc Protospacer
. .***.**.****************
243. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030644 (Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
244. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030436 (Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
245. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP019544 (Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
246. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP019546 (Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
247. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030629 (Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
248. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030597 (Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
249. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030662 (Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
250. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
251. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
attcaaatactttaataaataattataacc Protospacer
. .***.**.****************
252. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP020021 (Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
253. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030425 (Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
254. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020312 (Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
255. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030427 (Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
256. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP031887 (Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
257. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030694 (Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
258. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047842 (Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
259. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP014922 (Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
260. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030714 (Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
261. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029666 (Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
262. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014404 (Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
263. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030485 (Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
264. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016854 (Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
265. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030563 (Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
266. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030680 (Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
267. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_017345 (Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
268. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030509 (Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
269. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_009619 (Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
270. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030409 (Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
271. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030473 (Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
272. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030549 (Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
273. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014364 (Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
274. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP054445 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
275. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP040621 (Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
276. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP053638 (Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
277. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030593 (Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
278. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030511 (Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
279. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_MH068822 (Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
280. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_MH785258 (Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
281. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP042047 (Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
282. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030405 (Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
283. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030565 (Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
284. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP031891 (Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
285. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_009477 (Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
286. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030657 (Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
287. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP045473 (Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
288. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030517 (Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
289. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030707 (Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
290. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016857 (Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
291. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
aaatgaatattttaataaataattatatgc Protospacer
..* .******.**************
292. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
293. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
294. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013230 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
295. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP030325 (Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
296. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018956 (Staphylococcus aureus plasmid p18806-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
297. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP018767 (Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
298. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030383 (Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
299. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP039449 (Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
300. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030530 (Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
301. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030387 (Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
302. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP011527 (Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
303. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
304. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013956 (Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
305. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_003140 (Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
306. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP013954 (Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
307. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030477 (Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
308. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
309. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_LR130519 (Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
310. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020323 (Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
311. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030533 (Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
312. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030466 (Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
313. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030555 (Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
314. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP011529 (Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
315. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013292 (Staphylococcus aureus plasmid pWBG752, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
316. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013296 (Staphylococcus aureus plasmid SAP049A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
317. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018952 (Staphylococcus aureus plasmid pWBG747, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
318. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029677 (Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
319. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029199 (Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
320. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030616 (Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
321. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to LC377540 (Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
322. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_019150 (Staphylococcus aureus plasmid p18805-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
323. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030698 (Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
324. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP014063 (Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
325. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP007679 (Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
326. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020314 (Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
327. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030571 (Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
328. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030461 (Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
329. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030535 (Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
330. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030669 (Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
331. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013322 (Staphylococcus aureus plasmid SAP019A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
332. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013324 (Staphylococcus aureus plasmid SAP027A, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
333. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013326 (Staphylococcus aureus plasmid pWBG746, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
334. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030660 (Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
335. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP025250 (Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
336. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030690 (Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
337. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047848 (Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
338. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP009362 (Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
339. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP007177 (Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
340. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_007931 (Staphylococcus aureus plasmid pSA1379, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
341. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018957 (Staphylococcus aureus plasmid p18807-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
342. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018959 (Staphylococcus aureus plasmid p18808-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
343. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018961 (Staphylococcus aureus plasmid p18809-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
344. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018963 (Staphylococcus aureus plasmid p18810-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
345. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_018974 (Staphylococcus aureus plasmid p18811-P03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
346. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020325 (Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
347. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020319 (Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
348. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
349. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
350. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030433 (Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
351. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030528 (Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
352. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030625 (Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
353. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047831 (Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
354. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
355. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP048646 (Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
356. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
357. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
358. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
359. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
360. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
361. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP053635 (Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
362. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030676 (Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
363. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to MN909556 (Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
364. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030602 (Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
365. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030598 (Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
366. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP020321 (Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
367. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
368. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_AP014943 (Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
369. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030576 (Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
370. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030649 (Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
371. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
372. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP053637 (Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
373. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030408 (Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
374. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030578 (Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
375. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP040999 (Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
376. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030560 (Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
377. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP021906 (Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
378. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP029665 (Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
379. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030376 (Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
380. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030584 (Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
381. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP044105 (Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
382. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030401 (Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
383. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP043303 (Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
384. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP039996 (Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataattatattttaataaataattagttag Protospacer
. *** ******.************ .
385. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_010063 (Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
386. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
387. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NZ_CP022608 (Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
388. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to NC_021552 (Staphylococcus aureus CA-347 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
389. spacer 4.3|3812029|30|LR130532|CRISPRCasFinder matches to CP030519 (Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
ggaatgatatttcaataaataattataaca CRISPR spacer
ataatcatattttaataaataattagttag Protospacer
. *** ******.************ .
390. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.71
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tgggcgacggcggctcgctggatgccgaaga Protospacer
**.*** **************** . . *.
391. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.71
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
tcggcgtcggcggctcgctcgacttgaagac Protospacer
* .**************** **.*** . .
392. spacer 4.5|3812149|31|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to AP014383 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S44-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.71
tgagcgtcggcggctcgctggatttgcgcgg CRISPR spacer
aaagcctcggcggctcgttggatttcatcat Protospacer
.*** ***********.******* *.
393. spacer 4.6|3812209|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041206 (Rhizobium sp. NIBRBAC000502774 plasmid pMK-3, complete sequence) position: , mismatch: 9, identity: 0.719
aatgcatcagttgaacacaaaagtagcttttc CRISPR spacer
aatccatcagtcgaacacaaaaggtcggattg Protospacer
*** *******.*********** **
394. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NC_024216 (Bacillus phage CAM003, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aagagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
395. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to KJ489400 (Bacillus phage Hoody T, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
396. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MF288921 (Bacillus phage OTooleKemple52, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
397. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MH638310 (Bacillus phage Kamfam, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
398. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MK215646 (Bacillus phage vB_BthM-Goe5, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
399. spacer 4.14|3812697|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to MF498901 (Bacillus phage Anthony, complete genome) position: , mismatch: 9, identity: 0.719
-----tcctcatgtaattcctgtgccaactcaataag CRISPR spacer
aatagtc-----gtaatacctgtgccagctcaatact Protospacer
** ***** *********.*******
400. spacer 4.15|3812758|32|LR130532|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032328 (Azospirillum brasilense strain MTCC4035 plasmid p7, complete sequence) position: , mismatch: 9, identity: 0.719
agatatctgttccggcttccagcgttttgttg CRISPR spacer
gggcatgtgctccggcttccagcgtttcgggc Protospacer
.*..** **.*****************.*
401. spacer 4.16|3812029|32|LR130532|CRT matches to NC_015919 (Borreliella bissettii DN127 plasmid lp54, complete sequence) position: , mismatch: 9, identity: 0.719
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatgatatttaaaaaaataattaacgaatt Protospacer
. ********** ** ********* . * *
402. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
403. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
404. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
405. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
406. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
407. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
408. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
409. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
410. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
411. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
412. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
413. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
414. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
415. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
416. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
417. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
418. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
419. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
420. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
421. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
422. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
423. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
424. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
425. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
426. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
427. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
428. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
429. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
430. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
431. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
432. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
433. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
434. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
435. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
436. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
437. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
438. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
439. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
440. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
441. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
442. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
443. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
444. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
445. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
446. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
447. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
448. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
449. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
450. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
451. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
452. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
453. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
454. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
455. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
456. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
457. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
458. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
459. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
460. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
461. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
462. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
463. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
464. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
465. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
466. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
467. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
468. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
469. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
470. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
471. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
472. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
473. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
474. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
475. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
476. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
477. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
478. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
479. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
480. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
481. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
482. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
483. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
484. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
485. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
486. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
487. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
488. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
489. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
490. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
491. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
492. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
493. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
494. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
495. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
496. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
497. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
498. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
499. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
500. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
501. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
502. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
503. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
504. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
505. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
506. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
507. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
508. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
509. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
510. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
511. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
512. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
513. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
514. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
515. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
516. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
517. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
518. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
519. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
520. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
521. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
522. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
523. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
524. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
525. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
526. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
527. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
528. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
529. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
530. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
531. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
532. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
533. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
534. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
535. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
536. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
537. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
538. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
539. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
540. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
541. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
542. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
543. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
544. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
545. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
546. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
547. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
548. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
549. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
550. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
551. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
552. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
553. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
554. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
555. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
556. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
557. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
558. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
559. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
560. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
561. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
562. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
563. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
564. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
565. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
566. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
567. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
568. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
569. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
570. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
571. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
572. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
573. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
574. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
575. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
576. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
577. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
578. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
579. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
580. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
581. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
582. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
583. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
584. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
585. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
586. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
587. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
588. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
589. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
590. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
591. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
592. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
593. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
594. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
595. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
596. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
597. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
598. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
599. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
600. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
601. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
602. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
603. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
604. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
605. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
606. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
607. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
608. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
609. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
610. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
611. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
612. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
613. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
614. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
615. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
616. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
617. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
618. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
619. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
620. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
621. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
622. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
623. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
624. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
625. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
626. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
627. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
628. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
629. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
630. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
631. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
632. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
633. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
634. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
635. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
636. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
637. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
638. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
639. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
640. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
641. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
642. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
643. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
644. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
645. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
646. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
647. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
648. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
649. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
650. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
651. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
652. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
653. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
654. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
655. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
656. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
657. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
658. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
659. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
660. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
661. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
662. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
663. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
664. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
665. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
666. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
667. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
668. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
669. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
670. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
671. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
672. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
673. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
674. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
675. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
676. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
677. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
678. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
679. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
680. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
681. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
682. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
683. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
684. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
685. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
686. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
687. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
688. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
689. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
690. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
691. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
692. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
693. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
694. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
695. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
696. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
697. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
698. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
699. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
700. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
701. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
702. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
703. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
704. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
705. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
706. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
707. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
708. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
709. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
710. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
711. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
712. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
713. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
714. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
715. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
716. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
717. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
718. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
719. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
720. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
721. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
722. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
723. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
724. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
725. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
726. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
727. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
728. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
729. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
730. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
731. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
732. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
733. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
734. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
735. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
736. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
737. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
738. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
739. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
740. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
741. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
742. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
743. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
744. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
745. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
746. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
747. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
748. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
749. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
750. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
751. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
752. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
753. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
754. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
755. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
756. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
757. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
758. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
759. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
760. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
761. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
762. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
763. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
764. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
765. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
766. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
767. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
768. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
769. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
770. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
771. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
772. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
773. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
774. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
775. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
776. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
777. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
778. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
779. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
780. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
781. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
782. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
783. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
784. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
785. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
786. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
787. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
788. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
789. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
790. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
791. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
792. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
793. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
794. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
795. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
796. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
797. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
798. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
799. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
800. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
801. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
802. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
803. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
804. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
805. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
806. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
807. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
808. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
809. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
810. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
811. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
812. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
813. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
814. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
815. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
816. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
817. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
818. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
819. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
820. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
821. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
822. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
823. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
824. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
825. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
826. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
827. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
828. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
829. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
830. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
831. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
832. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
833. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
834. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
835. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
836. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
837. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
838. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
839. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
840. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
841. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
842. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
843. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
844. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
845. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
846. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
847. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
848. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
849. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
850. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
851. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
852. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
853. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
854. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
855. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
856. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
857. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
858. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
859. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
860. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
861. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
862. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
863. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
864. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
865. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
866. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
867. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
868. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
869. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
870. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
871. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
872. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
873. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
874. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
875. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
876. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
877. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
878. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
879. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
880. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
881. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
882. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
883. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
884. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
885. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
886. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
887. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
888. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
889. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
890. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
891. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
892. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
893. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
894. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
895. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
896. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
897. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
898. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
899. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
900. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
901. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
902. spacer 5.3|3838658|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
903. spacer 5.5|3838780|32|LR130532|CRISPRCasFinder,CRT matches to NC_019911 (Yersinia phage phi80-18 complete genome) position: , mismatch: 9, identity: 0.719
tgctttcctacgacaaatctggcgatgttgcg CRISPR spacer
gagtacctaacgacatatatggcgatgttgcg Protospacer
. * .*. ****** ** *************
904. spacer 5.5|3838780|32|LR130532|CRISPRCasFinder,CRT matches to NC_047805 (Yersinia phage fHe-Yen3-01, complete genome) position: , mismatch: 9, identity: 0.719
tgctttcctacgacaaatctggcgatgttgcg CRISPR spacer
gagtacctaacgacatatatggcgatgttgcg Protospacer
. * .*. ****** ** *************
905. spacer 5.7|3838902|32|LR130532|CRISPRCasFinder,CRT matches to MN693437 (Marine virus AFVG_25M476, complete genome) position: , mismatch: 9, identity: 0.719
ttgaactgttgatgttatcaaaatatcagctc CRISPR spacer
ttgatctgttgatgtaatcaaaaactattgtt Protospacer
**** ********** ******* * *.
906. spacer 5.10|3839085|32|LR130532|CRISPRCasFinder,CRT matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 9, identity: 0.719
agcagcaacaatatttcccgcagtgctgccag CRISPR spacer
ttcgacaaaaatagttcccgcagtgctgctga Protospacer
*..*** **** ***************...
907. spacer 5.10|3839085|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP050444 (Tolypothrix sp. PCC 7910 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
agcagcaac-aatatttcccgcagtgctgccag CRISPR spacer
-acgctggctaatgtttccagcagtgctgccag Protospacer
.*. ...* ***.***** *************
908. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
909. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
910. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
911. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
912. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
913. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
914. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
915. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KX710093 (Leclercia adecarboxylata strain pP10164 plasmid pP10164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
916. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
917. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
918. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
919. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
920. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN783747 (Klebsiella oxytoca plasmid pIron_OXY, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
921. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
922. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
923. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050847 (Klebsiella pneumoniae strain Bckp206 plasmid pBckp206-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
924. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
925. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
926. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
927. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029739 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
928. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
929. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
930. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
931. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
932. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
933. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_KT347600 (Escherichia coli strain EC5207 plasmid pEC5207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
934. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042628 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-1_MCR3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
935. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
936. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
937. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
938. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
939. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
940. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
941. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
942. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
943. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
944. spacer 5.13|3838659|32|LR130532|PILER-CR matches to KY486279 (Salmonella sp. strain SH-01 plasmid pSH-01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
945. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
946. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
947. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
948. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
949. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
950. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
951. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012256 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
952. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
953. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
954. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
955. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
956. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
957. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
958. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
959. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
960. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
961. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
962. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
963. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
964. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
965. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
966. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
967. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
968. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
969. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
970. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040652 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain SA20070548 plasmid pSA20070548.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
971. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
972. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
973. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
974. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
975. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
976. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
977. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
978. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
979. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
980. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
981. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
982. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
983. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
984. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
985. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
986. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035636 (Enterobacter cloacae strain EN3600 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
987. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
988. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP053738 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
989. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
990. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
991. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
992. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019559 (Escherichia coli strain KSC207 plasmid pMRGN207, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
993. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047092 (Salmonella sp. S13 plasmid pS13-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
994. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
995. spacer 5.13|3838659|32|LR130532|PILER-CR matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
996. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
997. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
998. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
999. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1000. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1001. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1002. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_020261 (Cronobacter sakazakii SP291 plasmid pSP291-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1003. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1004. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1005. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1006. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1007. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP006642 (Escherichia coli PCN061 plasmid PCN061p6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1008. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1009. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1010. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1011. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1012. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1013. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1014. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1015. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1016. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1017. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1018. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1019. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1020. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1021. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1022. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1023. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031547 (Escherichia coli strain cq9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1024. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1025. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1026. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1027. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1028. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1029. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1030. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1031. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1032. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1033. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1034. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1035. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1036. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1037. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1038. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1039. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1040. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1041. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1042. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP042639 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1043. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1044. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1045. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1046. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1047. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP044301 (Escherichia coli strain P59A plasmid pP59A-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1048. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1049. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025277 (Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60984 plasmid pSJO-60984, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1050. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP017182 (Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1051. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP013942 (Cronobacter malonaticus LMG 23826 plasmid pCMA2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1052. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1053. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1054. spacer 5.13|3838659|32|LR130532|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1055. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1056. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1057. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1058. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1059. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031569 (Enterobacter hormaechei strain 2013_1a plasmid pIncFIB-1301491, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1060. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1061. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1062. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1063. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1064. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052445 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1065. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1066. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1067. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040894 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1068. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1069. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1070. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1071. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1072. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1073. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1074. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1075. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1076. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1077. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1078. spacer 5.13|3838659|32|LR130532|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1079. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1080. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1081. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035916 (Salmonella enterica strain S61394 plasmid pLS61394-MCR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1082. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP039577 (Salmonella enterica subsp. enterica serovar Typhimurium strain PNCS014856 plasmid p10-3857.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1083. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1084. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1085. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1086. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1087. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1088. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1089. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1090. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019019 (Escherichia coli strain Ecol_244 plasmid pEC244_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1091. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1092. spacer 5.13|3838659|32|LR130532|PILER-CR matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1093. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1094. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042616 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1095. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1096. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1097. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1098. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050011 (Citrobacter sp. Y3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1099. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1100. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1101. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1102. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1103. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1104. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1105. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1106. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1107. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1108. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1109. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1110. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1111. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1112. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1113. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1114. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1115. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1116. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1117. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1118. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1119. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1120. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1121. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1122. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1123. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1124. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1125. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1126. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1127. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1128. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1129. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046273 (Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1130. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1131. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1132. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1133. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1134. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1135. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1136. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LT991959 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1137. spacer 5.13|3838659|32|LR130532|PILER-CR matches to LC511658 (Escherichia coli 2017.03.03CC plasmid p2017_03_03CC DNA, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1138. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029037 (Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1139. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1140. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP043854 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1141. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1142. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1143. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP039857 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014876 plasmid p15-0756.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1144. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1145. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1146. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1147. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1148. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1149. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1150. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1151. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1152. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1153. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1154. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1155. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1156. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1157. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1158. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026185 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9a0d, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1159. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1160. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1161. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031815 (Klebsiella pneumoniae strain KSB1_7F-sc-2280268 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1162. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1163. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1164. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1165. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1166. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP043751 (Escherichia coli strain CVM N62675 plasmid pN62675, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1167. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1168. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1169. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1170. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1171. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP019214 (Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1172. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1173. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1174. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1175. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP043545 (Escherichia coli strain F2_81 plasmid pF2_18C_HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1176. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012169 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-210.894kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1177. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1178. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1179. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1180. spacer 5.13|3838659|32|LR130532|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1181. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1182. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1183. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1184. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1185. spacer 5.13|3838659|32|LR130532|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1186. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1187. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1188. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1189. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1190. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1191. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1192. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1193. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1194. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1195. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1196. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1197. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1198. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1199. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1200. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1201. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1202. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1203. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024144 (Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1204. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1205. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1206. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1207. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1208. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1209. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1210. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1211. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1212. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1213. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1214. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1215. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1216. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1217. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1218. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1219. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1220. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1221. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1222. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1223. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1224. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1225. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1226. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1227. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1228. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1229. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1230. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1231. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1232. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1233. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1234. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1235. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1236. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1237. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024130 (Escherichia coli strain 14EC001 plasmid p14EC001c, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1238. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1239. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011429 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1240. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1241. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1242. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1243. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1244. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1245. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1246. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1247. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1248. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032495 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_118, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1249. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1250. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1251. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1252. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1253. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1254. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1255. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1256. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_005211 (Serratia marcescens plasmid R478, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1257. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1258. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1259. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026661 (Salmonella enterica subsp. enterica strain 15-SA01028 plasmid pSE15-SA01028, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1260. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1261. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1262. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1263. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1264. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1265. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1266. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1267. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1268. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1269. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1270. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1271. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1272. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1273. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1274. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1275. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1276. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045194 (Klebsiella pneumoniae strain YML0508 plasmid pYML0508_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1277. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1278. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1279. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1280. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1281. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1282. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1283. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1284. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1285. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1286. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1287. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP027603 (UNVERIFIED_ORG: Klebsiella pneumoniae strain AR_0080 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1288. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP017991 (Enterobacter cloacae complex sp. ECNIH7 plasmid pENT-1ac, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1289. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1290. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1291. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP046613 (Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1292. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1293. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1294. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1295. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1296. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1297. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1298. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1299. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1300. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1301. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1302. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1303. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1304. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP051274 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Partridge_SW-37 plasmid pSW37-267109, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1305. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033347 (Salmonella enterica subsp. enterica strain CFSA1096 plasmid pCFSA1096, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1306. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1307. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1308. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042541 (Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1309. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1310. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1311. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1312. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1313. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1314. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1315. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1316. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1317. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1318. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1319. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP051271 (Salmonella enterica subsp. enterica serovar Worthington strain OLF-FSR1_WB_Quail_SW-70 plasmid pSW37-267106, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1320. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1321. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1322. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1323. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1324. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1325. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1326. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1327. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1328. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1329. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033743 (Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1330. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1331. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1332. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1333. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1334. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1335. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_023025 (Cronobacter malonaticus plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1336. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1337. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1338. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1339. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP033798 (Enterobacter roggenkampii strain FDAARGOS_523 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1340. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1341. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035197 (Klebsiella pneumoniae strain LH375 plasmid pLH375_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1342. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1343. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1344. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1345. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1346. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1347. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1348. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1349. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1350. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1351. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1352. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1353. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1354. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1355. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1356. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024133 (Escherichia coli strain 14EC007 plasmid p14EC007b, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1357. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1358. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1359. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1360. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1361. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041629 (Escherichia coli strain PE15 plasmid pPE15-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1362. spacer 5.13|3838659|32|LR130532|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1363. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1364. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1365. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1366. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1367. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1368. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1369. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1370. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021697 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000161, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1371. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1372. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1373. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1374. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1375. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1376. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1377. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1378. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1379. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1380. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1381. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1382. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP043934 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1383. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1384. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1385. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1386. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1387. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050823 (Klebsiella pneumoniae strain Bckp091 plasmid pBckp091-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1388. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP050784 (Salmonella enterica subsp. enterica serovar Indiana strain SI67 plasmid pSI67-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1389. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1390. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1391. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1392. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1393. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1394. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1395. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1396. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1397. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1398. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1399. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1400. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1401. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MH884652 (Salmonella sp. strain Sa27 plasmid pSa27-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1402. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1403. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1404. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1405. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1406. spacer 5.13|3838659|32|LR130532|PILER-CR matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1407. spacer 5.13|3838659|32|LR130532|PILER-CR matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1408. spacer 5.13|3838659|32|LR130532|PILER-CR matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgataacgctgctgtgattcgtccccgt CRISPR spacer
atcaagataacgctgctgtgactcaagttgct Protospacer
**** ****************.**. .. *
1409. spacer 5.15|3838781|32|LR130532|PILER-CR matches to NC_019911 (Yersinia phage phi80-18 complete genome) position: , mismatch: 9, identity: 0.719
tgctttcctacgacaaatctggcgatgttgcg CRISPR spacer
gagtacctaacgacatatatggcgatgttgcg Protospacer
. * .*. ****** ** *************
1410. spacer 5.15|3838781|32|LR130532|PILER-CR matches to NC_047805 (Yersinia phage fHe-Yen3-01, complete genome) position: , mismatch: 9, identity: 0.719
tgctttcctacgacaaatctggcgatgttgcg CRISPR spacer
gagtacctaacgacatatatggcgatgttgcg Protospacer
. * .*. ****** ** *************
1411. spacer 5.17|3838903|32|LR130532|PILER-CR matches to MN693437 (Marine virus AFVG_25M476, complete genome) position: , mismatch: 9, identity: 0.719
ttgaactgttgatgttatcaaaatatcagctc CRISPR spacer
ttgatctgttgatgtaatcaaaaactattgtt Protospacer
**** ********** ******* * *.
1412. spacer 5.20|3839086|32|LR130532|PILER-CR matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 9, identity: 0.719
agcagcaacaatatttcccgcagtgctgccag CRISPR spacer
ttcgacaaaaatagttcccgcagtgctgctga Protospacer
*..*** **** ***************...
1413. spacer 5.20|3839086|32|LR130532|PILER-CR matches to NZ_CP050444 (Tolypothrix sp. PCC 7910 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
agcagcaac-aatatttcccgcagtgctgccag CRISPR spacer
-acgctggctaatgtttccagcagtgctgccag Protospacer
.*. ...* ***.***** *************
1414. spacer 4.16|3812029|32|LR130532|CRT matches to NC_016942 (Staphylococcus argenteus MSHR1132 plasmid pST75 complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1415. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029750 (Staphylococcus aureus strain Smith plasmid pSS41, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1416. spacer 4.16|3812029|32|LR130532|CRT matches to CP030488 (Staphylococcus aureus strain ER01009.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1417. spacer 4.16|3812029|32|LR130532|CRT matches to CP030517 (Staphylococcus aureus strain ER01116.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1418. spacer 4.16|3812029|32|LR130532|CRT matches to CP030707 (Staphylococcus aureus strain ER03493.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1419. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP053186 (Staphylococcus aureus strain Guangzhou-SAU749 plasmid pSAU749, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1420. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP016857 (Staphylococcus aureus subsp. aureus strain 1971.C01 plasmid p1971.C01c, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1421. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP053184 (Staphylococcus aureus strain Guangzhou-SAU071 plasmid pSAU071, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1422. spacer 4.16|3812029|32|LR130532|CRT matches to CP030633 (Staphylococcus aureus strain ER03755.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1423. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1424. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013228 (UNVERIFIED_ASMBLY: Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1425. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1426. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013229 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1427. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013230 (Staphylococcus aureus strain UTSW MRSA 55 plasmid UTSW55_4, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1428. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP030325 (Staphylococcus aureus strain AR_474 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1429. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018956 (Staphylococcus aureus plasmid p18806-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1430. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP018767 (Staphylococcus aureus subsp. aureus strain UCI62 plasmid pUCI62, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1431. spacer 4.16|3812029|32|LR130532|CRT matches to CP030383 (Staphylococcus aureus strain ER03761.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1432. spacer 4.16|3812029|32|LR130532|CRT matches to CP030587 (Staphylococcus aureus strain ER00594.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1433. spacer 4.16|3812029|32|LR130532|CRT matches to CP030607 (Staphylococcus aureus strain ER02693.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1434. spacer 4.16|3812029|32|LR130532|CRT matches to CP030663 (Staphylococcus aureus strain ER03489.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1435. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP039449 (Staphylococcus aureus strain VGC1 plasmid pVGC1_1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1436. spacer 4.16|3812029|32|LR130532|CRT matches to CP030385 (Staphylococcus aureus strain ER00959.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1437. spacer 4.16|3812029|32|LR130532|CRT matches to CP030530 (Staphylococcus aureus strain ER04421.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1438. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014408 (Staphylococcus aureus strain USA300-SUR12 plasmid pUSA04-1-SUR12, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1439. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014411 (Staphylococcus aureus strain USA300-SUR13 plasmid pUSA04-1-SUR13, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1440. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014367 (Staphylococcus aureus strain USA300-SUR2 plasmid pUSA04-1-SUR2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1441. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP054441 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1442. spacer 4.16|3812029|32|LR130532|CRT matches to LC383633 (Staphylococcus aureus SI1 plasmid pWSI1 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1443. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP031889 (Staphylococcus aureus strain CFSAN082782 plasmid pMRSA_23, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1444. spacer 4.16|3812029|32|LR130532|CRT matches to CP030387 (Staphylococcus aureus strain ER01062.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1445. spacer 4.16|3812029|32|LR130532|CRT matches to CP030513 (Staphylococcus aureus strain ER01817.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1446. spacer 4.16|3812029|32|LR130532|CRT matches to CP030666 (Staphylococcus aureus strain ER01454.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1447. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014386 (Staphylococcus aureus strain USA300-SUR7 plasmid pUSA04-3-SUR7, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1448. spacer 4.16|3812029|32|LR130532|CRT matches to CP030397 (Staphylococcus aureus strain ER01719.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1449. spacer 4.16|3812029|32|LR130532|CRT matches to CP030414 (Staphylococcus aureus strain ER03113.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1450. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP011527 (Staphylococcus aureus subsp. aureus DSM 20231 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1451. spacer 4.16|3812029|32|LR130532|CRT matches to CP030497 (Staphylococcus aureus strain ER02658.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1452. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013956 (Staphylococcus aureus strain NCCP14562 isolate Sequencing plasmid pNCCP14562, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1453. spacer 4.16|3812029|32|LR130532|CRT matches to NC_003140 (Staphylococcus aureus subsp. aureus N315 plasmid pN315, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1454. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP016862 (Staphylococcus aureus subsp. aureus strain 1625.C01 plasmid p1625.C01, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1455. spacer 4.16|3812029|32|LR130532|CRT matches to NC_010419 (Staphylococcus aureus plasmid pTZ2162, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1456. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP013954 (Staphylococcus aureus strain NCCP14558 plasmid pNCCP14558, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1457. spacer 4.16|3812029|32|LR130532|CRT matches to CP030416 (Staphylococcus aureus strain ER01836.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1458. spacer 4.16|3812029|32|LR130532|CRT matches to CP030477 (Staphylococcus aureus strain ER04436.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1459. spacer 4.16|3812029|32|LR130532|CRT matches to CP030521 (Staphylococcus aureus strain ER01564.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1460. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1461. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_LR130519 (Staphylococcus aureus strain BPH2986 isolate BPH2986 plasmid 2) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1462. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020323 (Staphylococcus aureus strain KUH180129 plasmid p01KUH180129, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1463. spacer 4.16|3812029|32|LR130532|CRT matches to CP030444 (Staphylococcus aureus strain ER01838.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1464. spacer 4.16|3812029|32|LR130532|CRT matches to CP030533 (Staphylococcus aureus strain ER02495.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1465. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014434 (Staphylococcus aureus strain USA300-SUR20 plasmid pUSA04-1-SUR20, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1466. spacer 4.16|3812029|32|LR130532|CRT matches to NC_010077 (Staphylococcus aureus plasmid EDINA, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1467. spacer 4.16|3812029|32|LR130532|CRT matches to CP030466 (Staphylococcus aureus strain ER04235.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1468. spacer 4.16|3812029|32|LR130532|CRT matches to CP030555 (Staphylococcus aureus strain PS00003.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1469. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP011529 (Staphylococcus aureus strain RKI4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1470. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013289 (Staphylococcus aureus plasmid SAP015A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1471. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013292 (Staphylococcus aureus plasmid pWBG752, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1472. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013294 (Staphylococcus aureus plasmid SAP046A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1473. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013296 (Staphylococcus aureus plasmid SAP049A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1474. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013298 (Staphylococcus aureus plasmid SAP050A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1475. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013299 (Staphylococcus aureus plasmid SAP051A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1476. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018952 (Staphylococcus aureus plasmid pWBG747, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1477. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029677 (Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1478. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP035102 (Staphylococcus aureus subsp. aureus strain ATCC 12600 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1479. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029199 (Staphylococcus aureus strain aureus plasmid pFORC_090.1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1480. spacer 4.16|3812029|32|LR130532|CRT matches to CP030523 (Staphylococcus aureus strain ER04163.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1481. spacer 4.16|3812029|32|LR130532|CRT matches to CP030616 (Staphylococcus aureus strain ER01560.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1482. spacer 4.16|3812029|32|LR130532|CRT matches to LC377540 (Staphylococcus aureus plasmid pNTUH_5066148 NTUH_5066148 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1483. spacer 4.16|3812029|32|LR130532|CRT matches to NC_019150 (Staphylococcus aureus plasmid p18805-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1484. spacer 4.16|3812029|32|LR130532|CRT matches to NC_019148 (Staphylococcus aureus PM1 plasmid pPM1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1485. spacer 4.16|3812029|32|LR130532|CRT matches to CP030442 (Staphylococcus aureus strain ER04385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1486. spacer 4.16|3812029|32|LR130532|CRT matches to CP030494 (Staphylococcus aureus strain ER03857.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1487. spacer 4.16|3812029|32|LR130532|CRT matches to CP030698 (Staphylococcus aureus strain ER01334.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1488. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014063 (Staphylococcus aureus strain FDAARGOS_159 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1489. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP007679 (Staphylococcus aureus strain HUV05 plasmid pHUV05-03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1490. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP030324 (Staphylococcus aureus strain AR_475 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1491. spacer 4.16|3812029|32|LR130532|CRT matches to MK933272 (Staphylococcus aureus subsp. aureus plasmid p4456, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1492. spacer 4.16|3812029|32|LR130532|CRT matches to MK933273 (Staphylococcus aureus subsp. aureus plasmid p6092, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1493. spacer 4.16|3812029|32|LR130532|CRT matches to MK933274 (Staphylococcus aureus subsp. aureus plasmid p6306, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1494. spacer 4.16|3812029|32|LR130532|CRT matches to MK933275 (Staphylococcus aureus subsp. aureus plasmid p6414-1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1495. spacer 4.16|3812029|32|LR130532|CRT matches to MK933276 (Staphylococcus aureus subsp. aureus plasmid p6530, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1496. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP017095 (Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1497. spacer 4.16|3812029|32|LR130532|CRT matches to NC_005127 (Staphylococcus aureus plasmid pUB101, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1498. spacer 4.16|3812029|32|LR130532|CRT matches to MK933268 (Staphylococcus aureus subsp. aureus plasmid p4578, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1499. spacer 4.16|3812029|32|LR130532|CRT matches to MK933269 (Staphylococcus aureus subsp. aureus plasmid p2-1850, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1500. spacer 4.16|3812029|32|LR130532|CRT matches to MK933270 (Staphylococcus aureus subsp. aureus plasmid p1070, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1501. spacer 4.16|3812029|32|LR130532|CRT matches to MK933271 (Staphylococcus aureus subsp. aureus plasmid p2575, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1502. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020314 (Staphylococcus aureus strain KUH140046 plasmid p01KUH140046, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1503. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP012118 (Staphylococcus aureus subsp. aureus strain USA300_2014.C01 plasmid pC01, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1504. spacer 4.16|3812029|32|LR130532|CRT matches to CP030571 (Staphylococcus aureus strain ER01892.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1505. spacer 4.16|3812029|32|LR130532|CRT matches to CP030567 (Staphylococcus aureus strain ER04242.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1506. spacer 4.16|3812029|32|LR130532|CRT matches to CP030461 (Staphylococcus aureus strain ER04013.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1507. spacer 4.16|3812029|32|LR130532|CRT matches to CP030535 (Staphylococcus aureus strain ER00749.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1508. spacer 4.16|3812029|32|LR130532|CRT matches to CP030643 (Staphylococcus aureus strain ER00385.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1509. spacer 4.16|3812029|32|LR130532|CRT matches to CP030669 (Staphylococcus aureus strain ER00951.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1510. spacer 4.16|3812029|32|LR130532|CRT matches to CP030623 (Staphylococcus aureus strain ER01524.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1511. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013322 (Staphylococcus aureus plasmid SAP019A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1512. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013324 (Staphylococcus aureus plasmid SAP027A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1513. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013326 (Staphylococcus aureus plasmid pWBG746, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1514. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013330 (Staphylococcus aureus plasmid pWBG759, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1515. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013332 (Staphylococcus aureus plasmid SAP052A, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1516. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013348 (Staphylococcus aureus plasmid pSK156, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1517. spacer 4.16|3812029|32|LR130532|CRT matches to CP030463 (Staphylococcus aureus strain ER00695.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1518. spacer 4.16|3812029|32|LR130532|CRT matches to CP030697 (Staphylococcus aureus strain ER01532.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1519. spacer 4.16|3812029|32|LR130532|CRT matches to NC_023278 (Staphylococcus aureus strain SA268 plasmid pSA268, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1520. spacer 4.16|3812029|32|LR130532|CRT matches to CP040802 (Staphylococcus aureus strain S15 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1521. spacer 4.16|3812029|32|LR130532|CRT matches to CP030446 (Staphylococcus aureus strain ER04127.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1522. spacer 4.16|3812029|32|LR130532|CRT matches to CP030536 (Staphylococcus aureus strain ER02094.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1523. spacer 4.16|3812029|32|LR130532|CRT matches to CP030660 (Staphylococcus aureus strain ER02217.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1524. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP025250 (Staphylococcus argenteus strain XNO106 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1525. spacer 4.16|3812029|32|LR130532|CRT matches to CP030539 (Staphylococcus aureus strain ER01935.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1526. spacer 4.16|3812029|32|LR130532|CRT matches to CP030690 (Staphylococcus aureus strain ER01507.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1527. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1528. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047848 (Staphylococcus aureus strain UP_522 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1529. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP009362 (Staphylococcus aureus subsp. aureus strain ATCC 25923 plasmid pS1945, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1530. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP007177 (Staphylococcus aureus USA300-ISMMS1 plasmid pUSA01-ISMMS, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1531. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029079 (Staphylococcus aureus strain AR466 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1532. spacer 4.16|3812029|32|LR130532|CRT matches to NC_007931 (Staphylococcus aureus plasmid pSA1379, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1533. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018957 (Staphylococcus aureus plasmid p18807-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1534. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018959 (Staphylococcus aureus plasmid p18808-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1535. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018961 (Staphylococcus aureus plasmid p18809-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1536. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018963 (Staphylococcus aureus plasmid p18810-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1537. spacer 4.16|3812029|32|LR130532|CRT matches to NC_018974 (Staphylococcus aureus plasmid p18811-P03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1538. spacer 4.16|3812029|32|LR130532|CRT matches to CP030700 (Staphylococcus aureus strain ER03023.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1539. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014394 (Staphylococcus aureus strain USA300-SUR9 plasmid pUSA04-2-SUR9, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1540. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020325 (Staphylococcus aureus strain KUN1163 plasmid p01KUN1163, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1541. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020319 (Staphylococcus aureus strain KUH180038 plasmid p01KUH180038, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1542. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014414 (Staphylococcus aureus strain USA300-SUR14 plasmid pUSA04-1-SUR14, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1543. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1544. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP025497 (Staphylococcus aureus subsp. aureus strain 3020.C01 plasmid p3020.C01b, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1545. spacer 4.16|3812029|32|LR130532|CRT matches to CP030672 (Staphylococcus aureus strain pt053 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1546. spacer 4.16|3812029|32|LR130532|CRT matches to CP030433 (Staphylococcus aureus strain ER00610.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1547. spacer 4.16|3812029|32|LR130532|CRT matches to CP030528 (Staphylococcus aureus strain ER02703.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1548. spacer 4.16|3812029|32|LR130532|CRT matches to CP030625 (Staphylococcus aureus strain ER03448.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1549. spacer 4.16|3812029|32|LR130532|CRT matches to CP030644 (Staphylococcus aureus strain ER03298.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1550. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047831 (Staphylococcus aureus strain UP_996 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1551. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1552. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP048646 (Staphylococcus aureus strain SR153 plasmid pSR03, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1553. spacer 4.16|3812029|32|LR130532|CRT matches to CP030436 (Staphylococcus aureus strain ER04086.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1554. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP019544 (Staphylococcus aureus strain KG-18 plasmid pKG-18, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1555. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP019546 (Staphylococcus aureus strain KG-22 plasmid pKG-22, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1556. spacer 4.16|3812029|32|LR130532|CRT matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1557. spacer 4.16|3812029|32|LR130532|CRT matches to CP030629 (Staphylococcus aureus strain ER03809.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1558. spacer 4.16|3812029|32|LR130532|CRT matches to CP030597 (Staphylococcus aureus strain ER02443.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1559. spacer 4.16|3812029|32|LR130532|CRT matches to CP030662 (Staphylococcus aureus strain ER02826.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1560. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1561. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP016860 (Staphylococcus aureus subsp. aureus strain 1969.N plasmid p1969.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1562. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1563. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP012121 (Staphylococcus aureus subsp. aureus strain USA300_2014.C02 plasmid pC02, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1564. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP053635 (Staphylococcus aureus strain 14638 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1565. spacer 4.16|3812029|32|LR130532|CRT matches to CP030676 (Staphylococcus aureus strain ER01533.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1566. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP020021 (Staphylococcus aureus subsp. aureus strain ATCC 6538 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1567. spacer 4.16|3812029|32|LR130532|CRT matches to MN909556 (Staphylococcus saprophyticus strain 1005578 plasmid p1005578_vga, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1568. spacer 4.16|3812029|32|LR130532|CRT matches to CP030425 (Staphylococcus aureus strain ER00551.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1569. spacer 4.16|3812029|32|LR130532|CRT matches to CP030602 (Staphylococcus aureus strain ER00658.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1570. spacer 4.16|3812029|32|LR130532|CRT matches to CP030598 (Staphylococcus aureus strain ER02524.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1571. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020312 (Staphylococcus aureus strain KUH140013 plasmid p01KUH140013, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1572. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP020321 (Staphylococcus aureus strain KUH180062 plasmid p01KUH180062, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1573. spacer 4.16|3812029|32|LR130532|CRT matches to CP030427 (Staphylococcus aureus strain ER04320.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1574. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1575. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP014943 (Staphylococcus aureus strain FDA209P plasmid pFDA209P, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1576. spacer 4.16|3812029|32|LR130532|CRT matches to CP030576 (Staphylococcus aureus strain ER03910.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1577. spacer 4.16|3812029|32|LR130532|CRT matches to CP030649 (Staphylococcus aureus strain ER03556.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1578. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1579. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP053637 (Staphylococcus aureus strain 14640 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1580. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP031887 (Staphylococcus aureus strain CFSAN082783 plasmid pMRSA_24, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1581. spacer 4.16|3812029|32|LR130532|CRT matches to CP030408 (Staphylococcus aureus strain PS00002.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1582. spacer 4.16|3812029|32|LR130532|CRT matches to CP030578 (Staphylococcus aureus strain ER01881.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1583. spacer 4.16|3812029|32|LR130532|CRT matches to CP030694 (Staphylococcus aureus strain ER01803.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1584. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP040999 (Staphylococcus aureus strain FDAARGOS_773 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1585. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP047842 (Staphylococcus aureus strain UP_644 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1586. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_AP014922 (Staphylococcus aureus strain JH4899 plasmid pJSA01, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1587. spacer 4.16|3812029|32|LR130532|CRT matches to CP030560 (Staphylococcus aureus strain ER01457.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1588. spacer 4.16|3812029|32|LR130532|CRT matches to CP030714 (Staphylococcus aureus strain ER02878.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1589. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029666 (Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1590. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014404 (Staphylococcus aureus strain USA300-SUR11 plasmid pUSA04-2-SUR11, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1591. spacer 4.16|3812029|32|LR130532|CRT matches to CP030485 (Staphylococcus aureus strain ER03913.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1592. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP021906 (Staphylococcus aureus strain Seattle 1945 isolate G477 plasmid pG477, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1593. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP029665 (Staphylococcus aureus strain AR_0226 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1594. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP016854 (Staphylococcus aureus subsp. aureus strain 5118.N plasmid p5118.Nb, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1595. spacer 4.16|3812029|32|LR130532|CRT matches to CP030376 (Staphylococcus aureus strain ER04041.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1596. spacer 4.16|3812029|32|LR130532|CRT matches to CP030563 (Staphylococcus aureus strain ER03720.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1597. spacer 4.16|3812029|32|LR130532|CRT matches to CP030680 (Staphylococcus aureus strain ER00573.3 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1598. spacer 4.16|3812029|32|LR130532|CRT matches to NC_017345 (Staphylococcus aureus subsp. aureus TCH60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1599. spacer 4.16|3812029|32|LR130532|CRT matches to CP030509 (Staphylococcus aureus strain ER00707.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1600. spacer 4.16|3812029|32|LR130532|CRT matches to CP030584 (Staphylococcus aureus strain ER02262.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1601. spacer 4.16|3812029|32|LR130532|CRT matches to NC_009619 (Staphylococcus aureus subsp. aureus JH1 plasmid pSJH101, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1602. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP044105 (Staphylococcus aureus strain FDAARGOS_660 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1603. spacer 4.16|3812029|32|LR130532|CRT matches to CP030401 (Staphylococcus aureus strain ER02637.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1604. spacer 4.16|3812029|32|LR130532|CRT matches to CP030409 (Staphylococcus aureus strain ER03996.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1605. spacer 4.16|3812029|32|LR130532|CRT matches to CP030473 (Staphylococcus aureus strain ER00767.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1606. spacer 4.16|3812029|32|LR130532|CRT matches to CP030549 (Staphylococcus aureus strain ER03928.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1607. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP043303 (Staphylococcus aureus strain 16445 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1608. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP039996 (Staphylococcus aureus subsp. aureus M013 plasmid pM013, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1609. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP014364 (Staphylococcus aureus strain USA300-SUR1 plasmid pUSA04-1-SUR1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1610. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP054445 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1611. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP040621 (Staphylococcus aureus strain J01 plasmid pJ01-02, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1612. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP053638 (Staphylococcus aureus strain 14732 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1613. spacer 4.16|3812029|32|LR130532|CRT matches to CP030593 (Staphylococcus aureus strain ER02989.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1614. spacer 4.16|3812029|32|LR130532|CRT matches to CP030511 (Staphylococcus aureus strain ER04636.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1615. spacer 4.16|3812029|32|LR130532|CRT matches to NC_010063 (Staphylococcus aureus subsp. aureus USA300_TCH1516 plasmid pUSA300HOUMR, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1616. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_MH068822 (Staphylococcus argenteus strain XNO62 plasmid pXNO62, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1617. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1618. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_MH785258 (Staphylococcus aureus strain ph1 plasmid pPH1-2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1619. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP042047 (Staphylococcus aureus strain B2-7A plasmid pSALNBL75, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1620. spacer 4.16|3812029|32|LR130532|CRT matches to CP030405 (Staphylococcus aureus strain ER04219.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1621. spacer 4.16|3812029|32|LR130532|CRT matches to CP030565 (Staphylococcus aureus strain ER01989.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1622. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP022608 (Staphylococcus aureus strain FORC_061 plasmid pFORC61_2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1623. spacer 4.16|3812029|32|LR130532|CRT matches to NC_021552 (Staphylococcus aureus CA-347 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1624. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP031891 (Staphylococcus aureus strain CFSAN082781 plasmid pMRSA_22, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1625. spacer 4.16|3812029|32|LR130532|CRT matches to NC_009477 (Staphylococcus aureus subsp. aureus JH9 plasmid pSJH901, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1626. spacer 4.16|3812029|32|LR130532|CRT matches to CP030519 (Staphylococcus aureus strain ER04332.3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1627. spacer 4.16|3812029|32|LR130532|CRT matches to CP030657 (Staphylococcus aureus strain ER04448.3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataatcatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1628. spacer 4.16|3812029|32|LR130532|CRT matches to NZ_CP045473 (Staphylococcus aureus strain ZY05 plasmid pZY05, complete sequence) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
ataattatattttaataaataattagttagtt Protospacer
. *** ******.************ . *
1629. spacer 4.16|3812029|32|LR130532|CRT matches to MG757166 (Gordonia phage SuperSulley, complete genome) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
atgatgatatttgaatgaataattatgtgaga Protospacer
. .********* ***.*********. *.
1630. spacer 4.16|3812029|32|LR130532|CRT matches to MF919510 (Gordonia phage Kabluna, complete genome) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
atgatgatatttgaatgaataattatgtgaga Protospacer
. .********* ***.*********. *.
1631. spacer 4.16|3812029|32|LR130532|CRT matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
aaaaagatacttcaataaataattaagaacgc Protospacer
..** ****.*************** .* ..
1632. spacer 4.16|3812029|32|LR130532|CRT matches to MH779499 (Gordonia phage Buggaboo, complete genome) position: , mismatch: 10, identity: 0.688
ggaatgatatttcaataaataattataacaat CRISPR spacer
atgatgatatttgaatgaataattatgtgaga Protospacer
. .********* ***.*********. *.
1633. spacer 5.10|3839085|32|LR130532|CRISPRCasFinder,CRT matches to NZ_CP011146 (Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence) position: , mismatch: 11, identity: 0.656
agcagcaacaatatttcccgcagtgctgccag CRISPR spacer
ttttccaacaatatttcctgccgtgctgggta Protospacer
. *************.** ****** .
1634. spacer 5.20|3839086|32|LR130532|PILER-CR matches to NZ_CP011146 (Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence) position: , mismatch: 11, identity: 0.656
agcagcaacaatatttcccgcagtgctgccag CRISPR spacer
ttttccaacaatatttcctgccgtgctgggta Protospacer
. *************.** ****** .
