Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
LR129840 | Streptococcus pneumoniae strain 4496 genome assembly, chromosome: 1 | 5 crisprs | 2 | 2 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR129840_1 | 130751-130846 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR129840_2 | 1100821-1100900 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR129840_3 | 1121175-1121287 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR129840_4 | 1264519-1264590 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR129840_5 | 1687759-1687908 | Orphan |
NA
|
3 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
LR129840_5 | 1687777-1687806 | 30 | LR129840.1 | 1685743-1685772 | 0 | 1.0 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1687909-1687926 | 1 | 0.944 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1682683-1682700 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1682947-1682964 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1683649-1683666 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1683745-1683762 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1685755-1685772 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1686025-1686042 | 2 | 0.889 | |
LR129840_5 | 1687825-1687842 | 18 | LR129840.1 | 1686121-1686138 | 2 | 0.889 |
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gcacttgtcgatgcggacgtgcttgcgctt Protospacer ******************************
gctgacgtacttgcgctt CRISPR spacer gctgacgtgcttgcgctt Protospacer ********.*********
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
gctgacgtacttgcgctt CRISPR spacer gcggacgtgcttgcgctt Protospacer ** *****.*********
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
gctgacgtacttgcgctt CRISPR spacer gctgacgcacttgtgctt Protospacer *******.*****.****
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
LR129840_5 | 1687777-1687806 | 30 | MT701594 | Streptomyces phage Spernnie, complete genome | 42475-42504 | 6 | 0.8 | |
LR129840_5 | 1687777-1687806 | 30 | KU197014 | Xanthomonas phage XAJ2, complete genome | 44358-44387 | 6 | 0.8 | |
LR129840_5 | 1687777-1687806 | 30 | MN234216 | Streptomyces phage Gilgamesh, complete genome | 110357-110386 | 6 | 0.8 | |
LR129840_5 | 1687861-1687890 | 30 | NZ_CP020040 | Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence | 443145-443174 | 6 | 0.8 | |
LR129840_5 | 1687777-1687806 | 30 | NZ_CP013104 | Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence | 1079324-1079353 | 7 | 0.767 | |
LR129840_5 | 1687777-1687806 | 30 | NZ_AP022593 | Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence | 2135227-2135256 | 7 | 0.767 | |
LR129840_5 | 1687777-1687806 | 30 | NZ_CP015867 | Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence | 424002-424031 | 8 | 0.733 | |
LR129840_5 | 1687777-1687806 | 30 | MG962371 | Mycobacterium phage LaterM, complete genome | 53081-53110 | 8 | 0.733 | |
LR129840_5 | 1687777-1687806 | 30 | KM677211 | Mycobacterium phage Murucutumbu, complete genome | 53625-53654 | 8 | 0.733 |
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gtacttgttgttgcggacgtgcttgcgggc Protospacer *.******.* **************** .
-gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer cgta-atgtcgatgtgaacgtgcttgcgctg Protospacer *.* ********.*.*************
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gccgttgacgatgcggacgtgctggcgggt Protospacer ** *** *************** *** *
--gctgacgtgcttgctgaggtcgacgcgctt CRISPR spacer cagttg--gtgcatgctgaggtcgacgcgggt Protospacer *.** **** **************** *
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gcgcggcccgatgcggacgtgctcgcgctg Protospacer **.* .***************.*****
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gatcttgtcgaagcggacgtccttgctcca Protospacer * ******** ******** ***** *.
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer cgagttgtcgatgcggacatgcttgaggag Protospacer * **************.****** *
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gccgaggtcgatgcggaggtgcttgcgtcg Protospacer ** *********** *********..
gcacttgtcgatgcggacgtgcttgcgctt CRISPR spacer gccgacgtcgatgcggaggtgcttgcgtcg Protospacer ** .*********** *********..
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|