Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR129840 Streptococcus pneumoniae strain 4496 genome assembly, chromosome: 1 5 crisprs NA 2 2 0 0

Results visualization

1. LR129840
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129840_1 130751-130846 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129840_2 1100821-1100900 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129840_3 1121175-1121287 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129840_4 1264519-1264590 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129840_5 1687759-1687908 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 LR129840.1 1685743-1685772 0 1.0
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1687909-1687926 1 0.944
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1682683-1682700 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1682947-1682964 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1683649-1683666 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1683745-1683762 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1685755-1685772 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1686025-1686042 2 0.889
LR129840_5 5.2|1687825|18|LR129840|CRT 1687825-1687842 18 LR129840.1 1686121-1686138 2 0.889

1. spacer 5.1|1687777|30|LR129840|CRT matches to position: 1685743-1685772, mismatch: 0, identity: 1.0

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gcacttgtcgatgcggacgtgcttgcgctt	Protospacer
******************************

2. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1687909-1687926, mismatch: 1, identity: 0.944

gctgacgtacttgcgctt	CRISPR spacer
gctgacgtgcttgcgctt	Protospacer
********.*********

3. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1682683-1682700, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

4. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1682947-1682964, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

5. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1683649-1683666, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

6. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1683745-1683762, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

7. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1685755-1685772, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gcggacgtgcttgcgctt	Protospacer
** *****.*********

8. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1686025-1686042, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

9. spacer 5.2|1687825|18|LR129840|CRT matches to position: 1686121-1686138, mismatch: 2, identity: 0.889

gctgacgtacttgcgctt	CRISPR spacer
gctgacgcacttgtgctt	Protospacer
*******.*****.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 MT701594 Streptomyces phage Spernnie, complete genome 42475-42504 6 0.8
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 KU197014 Xanthomonas phage XAJ2, complete genome 44358-44387 6 0.8
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 MN234216 Streptomyces phage Gilgamesh, complete genome 110357-110386 6 0.8
LR129840_5 5.3|1687861|30|LR129840|CRT 1687861-1687890 30 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 443145-443174 6 0.8
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1079324-1079353 7 0.767
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2135227-2135256 7 0.767
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 424002-424031 8 0.733
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 MG962371 Mycobacterium phage LaterM, complete genome 53081-53110 8 0.733
LR129840_5 5.1|1687777|30|LR129840|CRT 1687777-1687806 30 KM677211 Mycobacterium phage Murucutumbu, complete genome 53625-53654 8 0.733

1. spacer 5.1|1687777|30|LR129840|CRT matches to MT701594 (Streptomyces phage Spernnie, complete genome) position: , mismatch: 6, identity: 0.8

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gtacttgttgttgcggacgtgcttgcgggc	Protospacer
*.******.* ****************  .

2. spacer 5.1|1687777|30|LR129840|CRT matches to KU197014 (Xanthomonas phage XAJ2, complete genome) position: , mismatch: 6, identity: 0.8

-gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
cgta-atgtcgatgtgaacgtgcttgcgctg	Protospacer
 *.*  ********.*.************* 

3. spacer 5.1|1687777|30|LR129840|CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 6, identity: 0.8

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gccgttgacgatgcggacgtgctggcgggt	Protospacer
**  *** *************** ***  *

4. spacer 5.3|1687861|30|LR129840|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 6, identity: 0.8

--gctgacgtgcttgctgaggtcgacgcgctt	CRISPR spacer
cagttg--gtgcatgctgaggtcgacgcgggt	Protospacer
  *.**  **** ****************  *

5. spacer 5.1|1687777|30|LR129840|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gcgcggcccgatgcggacgtgctcgcgctg	Protospacer
**.*   .***************.***** 

6. spacer 5.1|1687777|30|LR129840|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gatcttgtcgaagcggacgtccttgctcca	Protospacer
*  ******** ******** ***** *. 

7. spacer 5.1|1687777|30|LR129840|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.733

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
cgagttgtcgatgcggacatgcttgaggag	Protospacer
  * **************.****** *   

8. spacer 5.1|1687777|30|LR129840|CRT matches to MG962371 (Mycobacterium phage LaterM, complete genome) position: , mismatch: 8, identity: 0.733

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gccgaggtcgatgcggaggtgcttgcgtcg	Protospacer
**    *********** *********.. 

9. spacer 5.1|1687777|30|LR129840|CRT matches to KM677211 (Mycobacterium phage Murucutumbu, complete genome) position: , mismatch: 8, identity: 0.733

gcacttgtcgatgcggacgtgcttgcgctt	CRISPR spacer
gccgacgtcgatgcggaggtgcttgcgtcg	Protospacer
**   .*********** *********.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage