Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR129841 Streptococcus pneumoniae strain 947 genome assembly, chromosome: 1 2 crisprs NA 3 2 0 0

Results visualization

1. LR129841
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129841_1 96265-96360 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR129841_2 1634594-1637659 Orphan NA
34 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR129841_2 2.10|1635218|18|LR129841|CRT 1635218-1635235 18 LR129841.1 1179592-1179609 1 0.944
LR129841_2 2.12|1635314|18|LR129841|CRT 1635314-1635331 18 LR129841.1 1179592-1179609 2 0.889
LR129841_2 2.17|1635590|18|LR129841|CRT 1635590-1635607 18 LR129841.1 1179592-1179609 2 0.889

1. spacer 2.10|1635218|18|LR129841|CRT matches to position: 1179592-1179609, mismatch: 1, identity: 0.944 

tgacgtgcttgctgacgt	CRISPR spacer
tgacttgcttgctgacgt	Protospacer
**** *************

2. spacer 2.12|1635314|18|LR129841|CRT matches to position: 1179592-1179609, mismatch: 2, identity: 0.889 

tgatgtgcttgctgacgt	CRISPR spacer
tgacttgcttgctgacgt	Protospacer
***. *************

3. spacer 2.17|1635590|18|LR129841|CRT matches to position: 1179592-1179609, mismatch: 2, identity: 0.889 

tgatgtgcttgctgacgt	CRISPR spacer
tgacttgcttgctgacgt	Protospacer
***. *************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR129841_2 2.13|1635350|30|LR129841|CRT 1635350-1635379 30 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 72512-72541 6 0.8
LR129841_2 2.13|1635350|30|LR129841|CRT 1635350-1635379 30 NZ_CP016309 Vibrio scophthalmi strain VS-12 plasmid pVS127, complete sequence 68522-68551 6 0.8
LR129841_2 2.9|1635170|30|LR129841|CRT 1635170-1635199 30 NZ_CP023039 Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence 97160-97189 7 0.767
LR129841_2 2.9|1635170|30|LR129841|CRT 1635170-1635199 30 KP054477 Lactobacillus phage LfeInf, complete genome 39480-39509 7 0.767
LR129841_2 2.9|1635170|30|LR129841|CRT 1635170-1635199 30 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 97005-97034 7 0.767
LR129841_2 2.13|1635350|30|LR129841|CRT 1635350-1635379 30 MH220877 Oenococcus phage phiOE33PA, complete genome 7681-7710 7 0.767
LR129841_2 2.13|1635350|30|LR129841|CRT 1635350-1635379 30 KP054477 Lactobacillus phage LfeInf, complete genome 39480-39509 8 0.733

1. spacer 2.13|1635350|30|LR129841|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 6, identity: 0.8 

tgatgtacttgcgcttgttgatgcg-gacgt	CRISPR spacer
acatgtacttgcgcatcttgatgcgcggcg-	Protospacer
  ************ * ******** *.**

2. spacer 2.13|1635350|30|LR129841|CRT matches to NZ_CP016309 (Vibrio scophthalmi strain VS-12 plasmid pVS127, complete sequence) position: , mismatch: 6, identity: 0.8 

tgatgtacttgcgcttgttgatgcggacgt	CRISPR spacer
tgatgcgcttgcgcttgttgatgtgcgtgt	Protospacer
*****..****************.* ..**

3. spacer 2.9|1635170|30|LR129841|CRT matches to NZ_CP023039 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

cgatgtacttgcgcttgtcgatgctgacgt	CRISPR spacer
ccggttacttgcgcttttcgatgctgaccg	Protospacer
* .  *********** ***********

4. spacer 2.9|1635170|30|LR129841|CRT matches to KP054477 (Lactobacillus phage LfeInf, complete genome) position: , mismatch: 7, identity: 0.767 

cgatgtacttgcgcttgtcgatgctgacgt	CRISPR spacer
agatgtacttgcgcttgtaggtgcttgact	Protospacer
 ***************** *.**** .  *

5. spacer 2.9|1635170|30|LR129841|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.767 

cgatgtacttgcgcttgtcgatgctgacgt	CRISPR spacer
cgatgaacttgcgcttgtcggtggcaaaga	Protospacer
***** **************.** ..* *

6. spacer 2.13|1635350|30|LR129841|CRT matches to MH220877 (Oenococcus phage phiOE33PA, complete genome) position: , mismatch: 7, identity: 0.767 

tgatgtacttgcgcttgttgatgcggacgt	CRISPR spacer
cgttcaacttgcgcttgttggtccggacgg	Protospacer
.* *  **************.* ******

7. spacer 2.13|1635350|30|LR129841|CRT matches to KP054477 (Lactobacillus phage LfeInf, complete genome) position: , mismatch: 8, identity: 0.733 

tgatgtacttgcgcttgttgatgcggacgt	CRISPR spacer
agatgtacttgcgcttgtaggtgcttgact	Protospacer
 ***************** *.***  .  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage