Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130239 Streptococcus pyogenes strain PS003 genome assembly, chromosome: 1 2 crisprs NA 0 1 0 0

Results visualization

1. LR130239
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130239_1 824644-824862 Orphan II-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130239_2 1270689-1270782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR130239_2 2.1|1270716|40|LR130239|CRISPRCasFinder 1270716-1270755 40 MK448679 Streptococcus phage Javan137, complete genome 35066-35105 8 0.8
LR130239_2 2.1|1270716|40|LR130239|CRISPRCasFinder 1270716-1270755 40 MK448950 Streptococcus phage Javan464, complete genome 37224-37263 9 0.775

1. spacer 2.1|1270716|40|LR130239|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 8, identity: 0.8

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
ctagtggctatgcggagttacttatccaaattatcgagga	Protospacer
***************************** * **..    

2. spacer 2.1|1270716|40|LR130239|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 9, identity: 0.775

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
cgagtggctatgcggagttgcttatccaactaatcgagga	Protospacer
* *****************.***********.**..    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage