CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
LR130239_2 |
2.1|1270716|40|LR130239|CRISPRCasFinder |
1270716-1270755 |
40 |
MK448679 |
Streptococcus phage Javan137, complete genome |
35066-35105 |
8 |
0.8 |
LR130239_2 |
2.1|1270716|40|LR130239|CRISPRCasFinder |
1270716-1270755 |
40 |
MK448950 |
Streptococcus phage Javan464, complete genome |
37224-37263 |
9 |
0.775 |
1. spacer 2.1|1270716|40|LR130239|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 8, identity: 0.8
ctagtggctatgcggagttacttatccaactgattatttt CRISPR spacer
ctagtggctatgcggagttacttatccaaattatcgagga Protospacer
***************************** * **..
2. spacer 2.1|1270716|40|LR130239|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 9, identity: 0.775
ctagtggctatgcggagttacttatccaactgattatttt CRISPR spacer
cgagtggctatgcggagttgcttatccaactaatcgagga Protospacer
* *****************.***********.**..