Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130510 Staphylococcus aureus strain BPH2760 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR130509 Staphylococcus aureus strain BPH2760 genome assembly, chromosome: 1 12 crisprs NA 3 3 0 0

Results visualization

1. LR130509
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_1 142175-142259 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_2 647206-647292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_3 851984-852065 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_4 1191993-1192085 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_5 1629829-1629914 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_6 1715697-1715783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_7 2116473-2116553 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_8 2128795-2128881 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_9 2243158-2243243 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_10 2394466-2394563 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_11 2410048-2410126 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130509_12 2549085-2549192 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR130509_1 1.1|142201|33|LR130509|CRISPRCasFinder 142201-142233 33 LR130509.1 1044521-1044553 0 1.0
LR130509_1 1.1|142201|33|LR130509|CRISPRCasFinder 142201-142233 33 LR130509.1 1326358-1326390 0 1.0
LR130509_1 1.1|142201|33|LR130509|CRISPRCasFinder 142201-142233 33 LR130509.1 1416118-1416150 0 1.0
LR130509_1 1.1|142201|33|LR130509|CRISPRCasFinder 142201-142233 33 LR130509.1 1925781-1925813 0 1.0
LR130509_3 3.1|852008|34|LR130509|CRISPRCasFinder 852008-852041 34 LR130509.1 1326357-1326390 1 0.971
LR130509_3 3.1|852008|34|LR130509|CRISPRCasFinder 852008-852041 34 LR130509.1 1416118-1416151 1 0.971
LR130509_9 9.1|2243188|26|LR130509|CRISPRCasFinder 2243188-2243213 26 LR130509.1 1119013-1119038 2 0.923

1. spacer 1.1|142201|33|LR130509|CRISPRCasFinder matches to position: 1044521-1044553, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

2. spacer 1.1|142201|33|LR130509|CRISPRCasFinder matches to position: 1326358-1326390, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

3. spacer 1.1|142201|33|LR130509|CRISPRCasFinder matches to position: 1416118-1416150, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

4. spacer 1.1|142201|33|LR130509|CRISPRCasFinder matches to position: 1925781-1925813, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

5. spacer 3.1|852008|34|LR130509|CRISPRCasFinder matches to position: 1326357-1326390, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

6. spacer 3.1|852008|34|LR130509|CRISPRCasFinder matches to position: 1416118-1416151, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

7. spacer 9.1|2243188|26|LR130509|CRISPRCasFinder matches to position: 1119013-1119038, mismatch: 2, identity: 0.923

tcgtcaccttctatgttggggccccg	CRISPR spacer
tcgtcagcttctgtgttggggccccg	Protospacer
****** *****.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR130509_6 6.1|1715727|27|LR130509|CRISPRCasFinder 1715727-1715753 27 KM359505 Prochlorococcus phage P-TIM68, complete genome 102710-102736 5 0.815
LR130509_8 8.1|2128822|33|LR130509|CRISPRCasFinder 2128822-2128854 33 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23035-23067 7 0.788
LR130509_8 8.1|2128822|33|LR130509|CRISPRCasFinder 2128822-2128854 33 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7568-7600 7 0.788
LR130509_5 5.1|1629856|32|LR130509|CRISPRCasFinder 1629856-1629887 32 MT889383 Mycobacterium phage MiniLon, complete genome 11248-11279 9 0.719
LR130509_5 5.1|1629856|32|LR130509|CRISPRCasFinder 1629856-1629887 32 KT281791 Mycobacterium phage Lolly9, complete genome 11248-11279 9 0.719

1. spacer 6.1|1715727|27|LR130509|CRISPRCasFinder matches to KM359505 (Prochlorococcus phage P-TIM68, complete genome) position: , mismatch: 5, identity: 0.815

gaatttcgaaaagaaattctacagacc	CRISPR spacer
ctatttccaaaagaaattatacagatc	Protospacer
  ***** ********** ******.*

2. spacer 8.1|2128822|33|LR130509|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 7, identity: 0.788

ttgcatatctttagctttattgtttgcaactga	CRISPR spacer
ttgcatatctttagctttatagcttttatatgc	Protospacer
******************** *.** .*  ** 

3. spacer 8.1|2128822|33|LR130509|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

ttgcatatctttagctttattgtttgcaactga	CRISPR spacer
ttgaataactttagctttattgttataaacagt	Protospacer
*** *** ****************   *** * 

4. spacer 5.1|1629856|32|LR130509|CRISPRCasFinder matches to MT889383 (Mycobacterium phage MiniLon, complete genome) position: , mismatch: 9, identity: 0.719

gcacattattgaaatctgacttttggtcagct	CRISPR spacer
accccttcttgaaatctgactttaggtcctga	Protospacer
.* * ** *************** ****    

5. spacer 5.1|1629856|32|LR130509|CRISPRCasFinder matches to KT281791 (Mycobacterium phage Lolly9, complete genome) position: , mismatch: 9, identity: 0.719

gcacattattgaaatctgacttttggtcagct	CRISPR spacer
accccttcttgaaatctgactttaggtcctga	Protospacer
.* * ** *************** ****    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage