Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
---|---|---|---|---|---|---|---|
LR130510 | Staphylococcus aureus strain BPH2760 genome assembly, plasmid: 2 | 0 crisprs | 0 | 0 | 0 | 0 | |
LR130509 | Staphylococcus aureus strain BPH2760 genome assembly, chromosome: 1 | 12 crisprs | 3 | 3 | 0 | 0 |
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_1 | 142175-142259 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_2 | 647206-647292 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_3 | 851984-852065 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_4 | 1191993-1192085 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_5 | 1629829-1629914 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_6 | 1715697-1715783 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_7 | 2116473-2116553 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_8 | 2128795-2128881 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_9 | 2243158-2243243 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_10 | 2394466-2394563 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_11 | 2410048-2410126 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
---|---|---|---|---|---|---|
LR130509_12 | 2549085-2549192 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|
LR130509_1 | 142201-142233 | 33 | LR130509.1 | 1044521-1044553 | 0 | 1.0 | |
LR130509_1 | 142201-142233 | 33 | LR130509.1 | 1326358-1326390 | 0 | 1.0 | |
LR130509_1 | 142201-142233 | 33 | LR130509.1 | 1416118-1416150 | 0 | 1.0 | |
LR130509_1 | 142201-142233 | 33 | LR130509.1 | 1925781-1925813 | 0 | 1.0 | |
LR130509_3 | 852008-852041 | 34 | LR130509.1 | 1326357-1326390 | 1 | 0.971 | |
LR130509_3 | 852008-852041 | 34 | LR130509.1 | 1416118-1416151 | 1 | 0.971 | |
LR130509_9 | 2243188-2243213 | 26 | LR130509.1 | 1119013-1119038 | 2 | 0.923 |
tgggccccaacaaagagaaattggattcccaat CRISPR spacer tgggccccaacaaagagaaattggattcccaat Protospacer *********************************
tgggccccaacaaagagaaattggattcccaat CRISPR spacer tgggccccaacaaagagaaattggattcccaat Protospacer *********************************
tgggccccaacaaagagaaattggattcccaat CRISPR spacer tgggccccaacaaagagaaattggattcccaat Protospacer *********************************
tgggccccaacaaagagaaattggattcccaat CRISPR spacer tgggccccaacaaagagaaattggattcccaat Protospacer *********************************
attgagaatccaatttctctttgttggggcccat CRISPR spacer attgggaatccaatttctctttgttggggcccat Protospacer ****.*****************************
attgagaatccaatttctctttgttggggcccat CRISPR spacer attgggaatccaatttctctttgttggggcccat Protospacer ****.*****************************
tcgtcaccttctatgttggggccccg CRISPR spacer tcgtcagcttctgtgttggggccccg Protospacer ****** *****.*************
CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
---|---|---|---|---|---|---|---|---|
LR130509_6 | 1715727-1715753 | 27 | KM359505 | Prochlorococcus phage P-TIM68, complete genome | 102710-102736 | 5 | 0.815 | |
LR130509_8 | 2128822-2128854 | 33 | JN882286 | Cronobacter phage vB_CsaP_GAP52, complete genome | 23035-23067 | 7 | 0.788 | |
LR130509_8 | 2128822-2128854 | 33 | CP030544 | Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence | 7568-7600 | 7 | 0.788 | |
LR130509_5 | 1629856-1629887 | 32 | MT889383 | Mycobacterium phage MiniLon, complete genome | 11248-11279 | 9 | 0.719 | |
LR130509_5 | 1629856-1629887 | 32 | KT281791 | Mycobacterium phage Lolly9, complete genome | 11248-11279 | 9 | 0.719 |
gaatttcgaaaagaaattctacagacc CRISPR spacer ctatttccaaaagaaattatacagatc Protospacer ***** ********** ******.*
ttgcatatctttagctttattgtttgcaactga CRISPR spacer ttgcatatctttagctttatagcttttatatgc Protospacer ******************** *.** .* **
ttgcatatctttagctttattgtttgcaactga CRISPR spacer ttgaataactttagctttattgttataaacagt Protospacer *** *** **************** *** *
gcacattattgaaatctgacttttggtcagct CRISPR spacer accccttcttgaaatctgactttaggtcctga Protospacer .* * ** *************** ****
gcacattattgaaatctgacttttggtcagct CRISPR spacer accccttcttgaaatctgactttaggtcctga Protospacer .* * ** *************** ****
Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
---|
Acr ID | Acr position | Acr size |
---|