Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR130513 Staphylococcus aureus strain BPH2900 genome assembly, chromosome: 1 6 crisprs NA 2 0 0 0
LR130514 Staphylococcus aureus strain BPH2900 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0

Results visualization

1. LR130513
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_1 625026-625113 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_2 907057-907141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_3 2218312-2218414 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_4 2298430-2298554 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_5 2540890-2540973 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR130513_6 2666735-2666816 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR130513_1 1.1|625056|28|LR130513|CRISPRCasFinder 625056-625083 28 LR130513.1 1969332-1969359 1 0.964
LR130513_6 6.1|2666759|34|LR130513|CRISPRCasFinder 2666759-2666792 34 LR130513.1 1006755-1006788 2 0.941

1. spacer 1.1|625056|28|LR130513|CRISPRCasFinder matches to position: 1969332-1969359, mismatch: 1, identity: 0.964 

ggtgtgggccccaacacagagaatttca	CRISPR spacer
ggtgtgggccccaacatagagaatttca	Protospacer
****************.***********

2. spacer 6.1|2666759|34|LR130513|CRISPRCasFinder matches to position: 1006755-1006788, mismatch: 2, identity: 0.941 

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagaggaattggatttccaat	Protospacer
******************.*********.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage